There is described herein a method for improving the anti-cancer properties of T-cells, the method comprising: providing a population of T-cells; and culturing the T-cells in an environment that activates the GCN2 pathway.
The invention relates to modulating the SIRPα-CD47 interaction in order to treat hematological cancer and compounds therefor. In some embodiments, there is provided methods and uses of SIRPα polypeptides, fragments and fusion proteins for treating hematological cancer, preferably human acute myeloid leukemia.
C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
A61K 38/16 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
The present disclosure is directed to antibodies or antigen-binding portions thereof that specifically bind free immunoglobulin light chains (FLC), polynucleotides and vectors encoding the same, and pharmaceutical compositions comprising the same. Some aspects of the disclosure are directed to methods of measuring FLC in a biological sample comprising contacting the sample with the anti-FLC antibody. Some aspects of the disclosure are directed to methods of treating a disease or condition comprising administering the anti-FLC antibody to a subject in need thereof.
Ontario Institute for Cancer Research (OICR) (Canada)
UNIVERSITY HEALTH NETWORK (Canada)
Inventor
Hopkins, Julia A.
Boutros, Paul
Bristow, Robert G.
Abstract
There is described herein a method of prognosing and/or predicting disease progression and/or in subject with prostate cancer, the method comprising: a) providing a sample containing mitochondrial genetic material from prostate cancer cells; b) sequencing the mitochondrial genetic material with respect to at least 1 patient biomarker selected from CSB1, OHR, ATP8 and HV1 (hypervariable region 1); c) comparing the sequence of said patient biomarkers to control or reference biomarkers to determine mitochondrial single nucleotide variations (mtSNVs); and d) determining the a prostate cancer prognosis; wherein a relatively worse outcome is associated with the presence of mtSNVs in CSB1, OHR, ATP8 and a relatively better outcome is associated with the presence of mtSNVs in HV1.
C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
G01N 33/574 - Immunoassay; Biospecific binding assay; Materials therefor for cancer
G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
C12Q 1/6881 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
6.
METHODS FOR GENERATING NEURAL PROGENITOR CELLS WITH A SPINAL CORD IDENTITY
Provided herein are methods of producing spNPCs from iPSCs or NPCs, cell populations, compositions comprising cell populations, and uses of spNPCs made using the methods described. The method can comprise: a. obtaining unpatterned NPCs, the unpatterned NPCs expressing neuroectodermal markers including Pax6 and Sox1; b. priming the unpatterned NPCs of step a; and c. patterning the primed unpatterned NPCs to produce spNPCS.
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
7.
METHODS OF TREATING SPONDYLOARTHRITIS OR SYMPTOMS THEREOF
Provided are methods of treating SpA, uses for treating SpA and compositions for treating SpA. The methods involve administering a MIF inhibitor to a subject in need thereof. The MIF inhibitor can be a compound or an anti-MIF antibody.
A61K 31/423 - Oxazoles condensed with carbocyclic rings
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A61P 19/02 - Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
8.
SYSTEMS, DEVICES, AND METHODS FOR VISUALIZATION OF TISSUE AND COLLECTION AND ANALYSIS OF DATA REGARDING SAME
A system for determining a bacterial load of a target is provided. The system includes an adaptor for configuring a mobile communication device for tissue imaging and a mobile communication device. The adaptor includes a housing configured to be removably coupled to a mobile communication device and, an excitation light source for fluorescent imaging. The excitation light source is configured to emit light in one of ultraviolet, visible, near-infrared, and infrared ranges.
Provided herein are methods of treating cancer using an effective amount of a compound represented by the formula: (I) or a pharmaceutically acceptable salt thereof and an effective amount of an immune checkpoint inhibitor. Also provided are compositions comprising the same compound represented by the formula shown above or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor.
Provided herein are methods of treating cancer using an effective amount of a compound represented by the formula: (I) or a pharmaceutically acceptable salt thereof and an effective amount of an immune checkpoint inhibitor. Also provided are compositions comprising the same compound represented by the formula shown above or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor.
Provided is a fixative composition comprising from at least 5 percent to 50 percent syrup, optionally honey, preferably, at least 10 syrup, and dextran and optionally coconut oil, optionally from at least 10 g/L to about 60 g/L of dextran, preferably about 50 g/L and/or from at least 0.5 percent to 15 percent coconut oil, preferably at least 1 percent coconut oil, methods of making the solution, methods of using the solution, for example methods for preserving a biological sample in said solution, and containers and kits comprising the solution.
Provided are methods for making yolk sac like hematopoietic progenitors by specifying a KDR+CD235a/b+ mesoderm cells capable of giving rise to T lymphoid lineage cells or cells differentiated therefrom. The method involves contacting pluripotent stem cells (PSCs) with a mesoderm specifying culture composition comprising a BMPR1/R2 agonist, an FGF receptor agonist and an activin receptor agonist to produce a KDR+CD235a/b+ mesoderm cells; and optionally isolating the KDR+CD235a/b+ mesoderm cells.
The present invention is related to a dual promoter lentiviral vector and methods of use for the treatment of diseases and disorders, specifically lysosomal storage disorders.
This disclosure describes vascular endothelial cells (VECs) and liver sinusoidal endothelial cells (LSECs), and methods and compositions for producing such cells.
A61P 1/16 - Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
14.
DEVICE AND METHOD FOR DETERMINING THE DEPTH OF A SUBSURFACE FLUORESCENT OBJECT WITHIN AN OPTICALLY ABSORBING AND SCATTERING MEDIUM AND FOR DETERMINING CONCENTRATION OF FLUOROPHORE OF THE OBJECT
A method and device for determining the depth and fluorophore concentration of a fluorophore concentration below the surface of an optically absorbing and scattering medium suitable for use in fluorescence-based surgical guidance such as in tumor resection is described. Long-wavelength stimulus light us used to obtain deep tissue penetration. Recovery of depth is performed by fitting measured modulation amplitudes for each spatial frequency to precomputed modulation amplitudes in a table of modulation amplitudes indexed by optical parameters and depth.
Systems and methods for determining bacterial load in targets are disclosed. An autofluorescence detection and collection device includes a light source configured to illuminate a target with excitation light causing at least one biomarker in the illuminated target to fluoresce. Bacterial autofluorescence data regarding the target is collected and analyzed to determine bacterial load the target. The autofluorescence data may be analyzed using pixel intensity.
Disclosed herein is an agent that modulates a cis interaction between Repulsive Guidance Molecule A (RGMa) and Neogenin or lipid rafts. Modulation by the agent may include blocking the cis interaction between RGMa and Neogenin and/or disrupting lipid rafts. In turn, this promotes neuronal cell survival and axon growth and/or regeneration. Also disclosed herein is a method of treating a disease in a subject in need thereof. The method may include administering the agent to the subject. Further disclosed herein is a method of identifying an agent that modulates the cis interaction between RGMa and Neogenin.
A61K 31/137 - Arylalkylamines, e.g. amphetamine, epinephrine, salbutamol, ephedrine
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A61K 31/7048 - Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin
A61K 38/48 - Hydrolases (3) acting on peptide bonds (3.4)
C07K 14/435 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans
A61K 31/495 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two nitrogen atoms as the only ring hetero atoms, e.g. piperazine
A61K 38/17 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans
G01N 33/50 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
17.
METHODS OF CAPTURING CELL-FREE METHYLATED DNA AND USES OF SAME
There is described herein, a method of capturing cell-free methylated DNA from a sample having less than 100 mg of cell-free DNA, comprising the steps of: subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA; adding a first amount of filler DNA to the sample, wherein at least a portion of the filler DNA is methylated; denaturing the sample; and capturing cell-free methylated DNA using a binder selective for methylated polynucleotides.
The present disclosure provides methods of prognosis of prostate cancer using mpMRl visibility biomarkers selected from SRD5A2, GNA11, CAPNS1, NCDN, WDR5 and/or LDHB.
G01N 33/574 - Immunoassay; Biospecific binding assay; Materials therefor for cancer
C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
19.
COMBINATION CYTOKINES FOR METHODS AND COMPOSITIONS FOR TREATING CANCER
Methods and compositions of whole cell vaccines for delivering immune modulatory molecules IL-12 and at least one of IL-21 and/or IL-18 to result in a therapeutic effect are disclosed. The methods and compositions use stably integrating lentiviral delivery systems. The methods are useful for therapeutically and prophylactically treating cancer such as leukemia.
There is described herein a method of assessing a subject's responsiveness to cancer therapy, comprising: providing a sample from the subject comprising cancers cells or suspected cancer cells; measuring or estimating the expression levels of inverted repeats (IR) Alus in the cells; and determining that the subject would be responsive to 5 cancer therapy if the subject cells exhibit expression levels of inverted repeats (IR) Alus with reference to expression levels in control samples.
C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
A61K 31/706 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
Inhibition of indoleamine 2,3-dioxygenase (IDO1) is an attractive immunotherapeutic approach for the treatment of a variety of cancers. Dysregulation of this enzyme has also been implicated in other severe diseases such as Alzheimer's disease and arthritis. Small molecule inhibitors of IDO, syntheses, and uses thereof are provided.
C07D 403/04 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group containing two hetero rings directly linked by a ring-member-to-ring- member bond
C07D 401/14 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
22.
METHODS AND COMPOSITIONS FOR MAKING AND USING ENDOCARDIAL CELLS
THE GOVERNING COUNCIL OF THE UNIVERSITY OF TORONTO (Canada)
UNIVERSITY HEALTH NETWORK (Canada)
Inventor
Liaqat, Daniyal
Abdalla, Mohamed
De Lara, Eyal
Rudzicz, Frank
Gershon, Andrea
Wu, Robert
Abstract
Systems and methods for filtering time-varying data for filtering and extracting a predicted physiological signal. A method including: segmenting the time-varying data into temporal windows; using a trained filter machine learning model, predicting an error for each prediction of the physiological signal for each window of time-varying data, the filter machine learning model trained using physiological signal predictions based on training time-varying data and known values of the physiological signal for the training time-varying data; discarding each window of time-varying data when the predicted error for such window is greater than a threshold; and where the window of time-varying data is not discarded, outputting at least one of the window of time-varying data and the predicted error for each prediction of the physiological signal.
A61B 5/02 - Measuring pulse, heart rate, blood pressure or blood flow; Combined pulse/heart-rate/blood pressure determination; Evaluating a cardiovascular condition not otherwise provided for, e.g. using combinations of techniques provided for in this group with electrocardiography; Heart catheters for measuring blood pressure
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
24.
TRANSGENIC PHOTORECEPTORS AND THEIR USE IN VISION TREATMENT
There is described herein a photoreceptor cell comprising a neurotoxin transgene, methods for making the same, and use of the same for vision treatment.
An adaptor for configuring a mobile communication device for tissue imaging is disclosed. The adaptor includes a housing configured to be removably coupled to a mobile communication device, at least one excitation light source for fluorescent imaging, a white light source for white light imaging, and a power source for powering the adaptor. The excitation light source is configured to emit light in one of ultraviolet, visible, near-infrared, and infrared ranges.
COMPOSITIONS AND METHODS FOR ENHANCING ACTIVATION AND CYTOLYTIC ACTIVITY OF CD8+ T CELLS THROUGH DISRUPTION OF THE SAGA (SPT-ADA-GCN5-ACETYLTRANSFERASE) COMPLEX
Methods of increasing T cell effector function in a T cell population are provided that involve inhibiting one or more genetic subunits of the SAGA (Spt-Ada-Gcn5-acetyltransferase) gene regulation complex in the T cell population. Also provided are methods of using such T cell populations in the treatment of cancer patients.
In an aspect, there is provided a method of detecting the presence of ctDNA from cancer cells in a subject comprising: (a) providing a sample of cell-free DNA from a subject; (b) subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA; (c) optionally adding a first amount of filler DNA to the sample, wherein at least a portion of the filler DNA is methylated, then further optionally denaturing the sample; (d) capturing cell-free methylated DNA using a binder selective for methylated polynucleotides; (e) sequencing the captured cell-free methylated DNA; (f) comparing the sequences of the captured cell-free methylated DNA to control cell-free methylated DNAs sequences from healthy and cancerous individuals; (g) identifying the presence of DNA from cancer cells if there is a statistically significant similarity between one or more sequences of the captured cell-free methylated DNA and cell-free methylated DNAs sequences from cancerous individuals; wherein in at least one of the capturing step, the comparing step or the identifying step, the subject cell-free methylated DNA is limited to a sub-population according to a fragment length metric.
C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
G16B 30/00 - ICT specially adapted for sequence analysis involving nucleotides or amino acids
28.
METHODS OF CAPTURING CELL-FREE METHYLATED DNA AND USES OF SAME
There is described herein, a method of capturing cell-free methylated DNA from a sample having less than 100 mg of cell-free DNA, comprising the steps of: subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA; adding a first amount of filler DNA to the sample, wherein at least a portion of the filler DNA is methylated; denaturing the sample; and capturing cell-free methylated DNA using a binder selective for methylated polynucleotides.
Recent literature on SARS-CoV-2 pathogenesis has suggested that the induction of substantial acute respiratory distress phenotypes is driven by a mismatched inflammatory response together with broad vascular dysfunction. While several detailed reports implementing multi-omic approaches have provided insight into the immune cell phenotypes involved in these processes, risk stratifying markers specific to COVID-19 and the vasculature have not been explored. Provided herein is a comprehensive, multi-omics-based description of the molecular antecedents to COVID-19 mortality, yielding new insights pertaining to the vasculature while highlighting the urgent need for clinical translation of novel biomarkers for disease prognosis.
G01N 33/569 - Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
C12Q 1/70 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
30.
PEPTIDE-HLA COMPLEXES AND METHODS OF PRODUCING SAME
There is provided herein, the use of mammalian derived HLA class I molecule for in vitro peptide exchange. For example, there is provided a method of producing an HLA class I molecule complexed to a pre-selected peptide comprising: (a) providing a mammalian derived HLA class I molecule complexed to an existing peptide; (b) incubating, in vitro, the HLA class I molecule complexed to the existing peptide with the pre-selected peptide, wherein the pre-selected peptide is at a concentration sufficient to replace the existing peptide to produce the HLA class I molecule complexed to the pre-selected peptide; and the HLA class I molecule comprises α1, α2, α3 and β2m domains.
A system and method for non-invasively detecting abnormal electrical propagation in the heart are disclosed. The system and method include an interface for receiving a pacing signal applied to a heart of a patient, the pacing signal comprising (i) a sequence of regular pacing stimuli shorter than the sinus-rate intervals, and (ii) one or more extra pacing stimuli at intervals that are shorter than the regular pacing stimuli, a processor to assess the envelope of a body-surface ECG component after the regular pacing stimuli, assess the envelope of a body surface ECG component after the one or more extra pacing stimuli, and compare the assessed component after the extra pacing stimuli to the assessed component after the regular pacing stimuli. The interface outputting the comparison as an indication of regions of arrhythmogenicity and ablation targets in the heart.
A novel salt form of Compound (I) represented by the following structural formula, and its corresponding pharmaceutical compositions, are disclosed. (I), Particular single crystalline forms of 1:1 Compound (I) tartrate salt are characterized by a variety of properties and physical measurements. Methods of preparing specific crystalline forms are also disclosed. The present disclosure also provides methods of treating cancer in a subject.
A novel salt form of Compound (I) represented by the following structural formula, and its corresponding pharmaceutical compositions, are disclosed. (I), Particular single crystalline forms of 1:1 Compound (I) tartrate salt are characterized by a variety of properties and physical measurements. Methods of preparing specific crystalline forms are also disclosed. The present disclosure also provides methods of treating cancer in a subject.
Provided herein are methods of treating triple negative breast cancer using an effective amount of Compound (I) represented by the formula: or a pharmaceutically acceptable salt thereof and an effective amount of an immune checkpoint inhibitor, wherein the checkpoint inhibitor is a PD-1 inhibitor or a PD-L1 inhibitor. Uses of an effective amount of Compound [I] and an effective amount of an immune checkpoint inhibitor, wherein the checkpoint inhibitor is a PD-linhibitor or a PD-L1 inhibitor for treating triple negative breast cancer are also provided herein.
A61K 31/5377 - 1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A61K 45/06 - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
34.
USE OF CD34 AS A MARKER FOR SINOATRIAL NODE-LIKE PACEMAKER CELLS
The invention relates to the use of CD34 as a cell surface marker to detect sinoatrial node-like pacemaker cells (SANLPCs) in a population of cells and to generate cell preparations highly enriched for SANLPCs. Also provides herein are methods of using SANLPC-enriched cell preparations for cardiac cell therapy.
C12N 5/077 - Mesenchymal cells, e.g. bone cells, cartilage cells, marrow stromal cells, fat cells or muscle cells
G01N 33/569 - Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
C12Q 1/6881 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
An organ perfusion solution includes a colloid component, a salt mixture, a buffer system, and a glutamine compound in a physiologically acceptable medium.
The present application provides a method of treating a condition associated with coronavirus infection, the condition selected from acute respiratory distress, lung inflammation, systemic inflammation, or cytokine storm, the method comprising administration of furosemide or a pharmaceutically acceptable salt or hydrate thereof.
A61K 31/341 - Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide not condensed with another ring, e.g. ranitidine, furosemide, bufetolol, muscarine
Disclosed herein is a method of treating a subject with aberrant cytokine release from a disease or condition or at risk of developing aberrant cytokine release from a disease or condition. The method comprises administering to the subject an effective amount of a compound represented by structural formula (I): (I) or a pharmaceutically acceptable salt thereof. The variables in structural formula (I) are as described herein.
Disclosed herein is a method of treating a subject with aberrant cytokine release from a disease or condition or at risk of developing aberrant cytokine release from a disease or condition. The method comprises administering to the subject an effective amount of a compound represented by structural formula (I): (I) or a pharmaceutically acceptable salt thereof. The variables in structural formula (I) are as described herein.
There is provided herein a method for expanding human CD4−CD8− regulatory T cells (DN Tregs) from a population of cells comprising DN Tregs, comprising: culturing the population of cells with artificial antigen presenting cells (APCs), preferably the DN Tregs are αβ-TCR+CD56− or alternatively γδ-TCR+.
There is disclosed herein compositions, methods, uses and systems for reducing pain in a patient that emanates from a body area, preferably spine or joint. Methods of treatment or prevention are described for a disease or condition selected from degenerative disc disease, disc injury, pain, arthritis, or suspected arthritis.
A61K 47/20 - Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing sulfur, e.g. dimethyl sulfoxide [DMSO], docusate, sodium lauryl sulfate or aminosulfonic acids
A61K 47/36 - Polysaccharides; Derivatives thereof, e.g. gums, starch, alginate, dextrin, hyaluronic acid, chitosan, inulin, agar or pectin
Methods and kits for screening, diagnosing, detecting or predicting a patient outcome/risk in a patient with a respiratory illness, the method comprising: a. obtaining a sample obtained from the patient; b. quantitatively measuring in the sample a polypeptide level of one or more biomarkers selected from: IL-6, CXCL8, IL-10, IL-IRA, IL-2, IL-4, IL-7, IL-9, IL-13, IL-17, IFN-g, IP-10, MCP-1, G-CSF, GM-CSF, FGF-basic, SCGF-β, GRO-α, MIP1-α, MIP1-β, CK-18, PDGF-bb, caspase 3, HMGB-1, TNF α, VEGF, sTNFR1 and sTREM1; and c. i) comparing the level of the one or more biomarkers in the sample with a control or cut-off level, wherein the differential level is indicative of patient outcome risk; or ii) using the polypeptide level of several of the biomarkers in combination, as inputs for an algebraic calculation or machine learning model of patient outcome risk.
G01N 33/68 - Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
41.
Method and apparatus for quantitative and depth resolved hyperspectral fluorescence and reflectance imaging for surgical guidance
An imaging system, such as a surgical microscope, laparoscope, or endoscope or integrated with these devices, includes an illuminator providing patterned white light and/or fluorescent stimulus light. The system receives and images light hyperspectrally, in embodiments using a hyperspectral imaging array, and/or using narrowband tunable filters for passing filtered received light to an imager. Embodiments may construct a 3-D surface model from stereo images, and will estimate optical properties of the target using images taken in patterned light or using other approximations obtained from white light exposures. Hyperspectral images taken under stimulus light are displayed as fluorescent images, and corrected for optical properties of tissue to provide quantitative maps of fluorophore concentration. Spectral information from hyperspectral images is processed to provide depth of fluorophore below the tissue surface. Quantitative images of fluorescence at depth are also prepared. The images are displayed to a surgeon for use in surgery.
A61B 5/1455 - Measuring characteristics of blood in vivo, e.g. gas concentration, pH-value using optical sensors, e.g. spectral photometrical oximeters
A61B 5/1459 - Measuring characteristics of blood in vivo, e.g. gas concentration, pH-value using optical sensors, e.g. spectral photometrical oximeters invasive, e.g. introduced into the body by a catheter
A61B 1/04 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor combined with photographic or television appliances
A61B 5/145 - Measuring characteristics of blood in vivo, e.g. gas concentration, pH-value
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
A61B 5/1495 - Calibrating or testing in vivo probes
A61B 1/06 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor with illuminating arrangements
A61B 5/055 - Detecting, measuring or recording for diagnosis by means of electric currents or magnetic fields; Measuring using microwaves or radio waves involving electronic [EMR] or nuclear [NMR] magnetic resonance, e.g. magnetic resonance imaging
A61B 1/05 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor combined with photographic or television appliances characterised by the image sensor, e.g. camera, being in the distal end portion
G01J 3/12 - Generating the spectrum; Monochromators
A61B 1/00 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor
A61B 1/07 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor with illuminating arrangements using light-conductive means, e.g. optical fibres
A61B 1/313 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor for introducing through surgical openings, e.g. laparoscopes
Methods of treating T cells with Venetoclax to increase T cell-mediated cytotoxicity and/or T cell mediated anti-tumor activity are described. Also described are populations of enhanced T cells as well as associated methods and uses for the treatment of cancer.
A61K 31/635 - Compounds containing para-N-benzene- sulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonohydrazide having a heterocyclic ring, e.g. sulfadiazine
There is described herein, a method of capturing and analyzing cell-free methylated DNA in a sample. The method involves subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA. A predetermined amount of control synthetic DNA fragments are added to the sample. The control synthetic DNA fragments each have a known nucleic acid sequence that does not align to a target genome sequence, and at least some of the control synthetic DNA fragments are methylated. The sample is denatured, and cell-free methylated DNA and the control synthetic DNA fragments are captured using a binder selective for methylated polynucleotides. The captured DNA is amplified and sequenced.
The disclosure relates to the development and use of CD4− CD8− double negative T (DNT) cells genetically modified to bind to one or more target antigens to enhance DNT cell anti-cancer activity such as with a chimeric antigen receptor (CAR). Genetically modified DNT cells can be generated ex vivo and expanded from allogeneic healthy donor cells and used as off-the-shelf therapy to overcome allogeneic graft-versus-host disease (GvHD) and/or host-versus-graft rejection in the treatment of cancer.
The invention is related to a method of treating a subject with acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, non-Hodgkin’s lymphoma, Burkitt lymphoma, or diffuse large B-cell lymphoma, or myelodysplastic syndrome by administration of Compound (I): (I), or a pharmaceutically acceptable salt thereof.
A61K 31/5377 - 1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
A61K 31/635 - Compounds containing para-N-benzene- sulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonohydrazide having a heterocyclic ring, e.g. sulfadiazine
A61K 31/706 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
A system for outputting a representation of a wound in tissue comprises a housing configured to removably receive at least a portion of a wireless communication device. At least one light source coupled to the housing is configured to emit excitation light to illuminate a target which includes at least a portion of the wound. A power supply contained in the housing is configured to provide power to the light source. A non-transitory computer-readable medium stores a program executable to cause the performance of operations comprising detecting signals responsive to illumination of the target, outputting the representation of the target based thereon, storing data relative to one or more target surface parameter based on the detected signals, and displaying the representation. The signals correspond to at least one of endogenous or exogeneous fluorescence, absorbance, and reflectance from at least one biological component in and/or on the target.
There is described herein a cell culture medium comprising: a basal medium; an antibiotic; B27; Noggin; Y-27632; Human FGF10 or FGF7; preferably wherein there is an absence of a Wnt agonist. Methods and uses of the medium is also described.
There is described herein a method for capturing circulating tumor DNA (ctDNA) of interest from an animal sample, preferably a mammalian sample, further preferably a human patient sample, comprising cell-free DNA (cfDNA), the method comprising: adding to the patient sample a library of nucleic acid hybrid capture probes, wherein the library of 5 probes is complementary to both strands of the double stranded ctDNA of interest and the probes are tagged for capture; allowing the probes to hybridize to the ctDNA; and capturing the hybridized ctDNA using the tag on the probes. Libraries of probes for use with these methods are also described.
C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
C12Q 1/70 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
Described herein are methods and compositions for screening cancer cells for sensitivity to itraconazole and use of itraconazole in treatment of cancer.
Methods and related systems and devices are described for performing various AR medical applications, including a method of guiding augmented reality (AR) intervention. In one aspect, a primary client device: receives model sets, an intervention plan having an intervention field, and session information about a session related to the AR intervention from a server; receives first real-time input data from a first input device; generates metrics by evaluating an execution of the intervention plan by comparing the intervention plan to the first real-time input data; displays real-time graphics, based at least in part on the metrics, spatially over the intervention field; receives real-time status data, from the server, about a replicate client device that joins the session; sends the first real-time input data, the metrics and the evaluation computed from the intervention plan, through the server, to the replicate client device.
Various embodiments are described herein for a bipolar catheter that generally comprises: a catheter body having a distal end portion and a proximal end portion; a first electrode at the distal end portion, the first electrode being on a spiral structure for rotational insertion into a physiological target region; a second electrode at the proximal end portion and spaced apart from the first electrode; and first and second electrode terminals spaced apart from one another at the proximal end portion and electrically coupled to the first and second electrodes respectively. The first and second electrodes are configured to function as active and dispersive electrodes respectively, or vice-versa. Also described are various embodiments of methods which generally include coupling the bipolar catheter to a signal generator; inserting the bipolar catheter at a physiological target region; and performing the procedure.
Methods and kits for screening, diagnosing, detecting or predicting a patient outcome/risk variable for a lung transplant recipient after transplant or an EVLP outcome by measuring biomarker levels of at least three biomarkers selected from IL-6, IL-8, IL-10 and IL-1β optionally in combination with one or both of sTNFR1 and sTREM1 in EVLP perfusate are described. The methods involve for example, i. obtaining one or more test EVLP perfusate samples of a donor lung; ii. determining in one or more test EVLP perfusate sample of a donor lung, a polypeptide level of the at least three biomarkers selected from IL-8, IL-6, IL-10 and IL-1β and optionally one or both of sTNFR1 and sTREM1 i; and iii. a) comparing the one or more parameter values related to a level of the at least three biomarkers in the perfusate sample with control EVLP data or a cut-off level, wherein the differential level is indicative of outcome/risk of after transplant or of an EVLP outcome; or b) using the one or more parameter values related to a level of the at least three biomarkers in combination, as part of an algebraic calculation or model of outcome/risk.
G16H 10/40 - ICT specially adapted for the handling or processing of patient-related medical or healthcare data for data related to laboratory analysis, e.g. patient specimen analysis
G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
53.
DONOR ORGAN PRESERVATION USING BOTH STATIC COLD STORAGE AND EX VIVO ORGAN PERFUSION
Methods, systems, and devices preserve donor organs by alternating between static cold storage and ex vivo organ perfusion. Preserving a donor organ includes refrigerating a donor organ to form a once-refrigerated donor organ, perfusing the once-refrigerated donor organ to form a once-perfused donor organ, and refrigerating the once-perfused donor organ to form a preserved, twice-refrigerated donor organ for transplantation.
The present disclosure is directed recombinant T cell receptors capable of binding a tyrosinase epitope, a MAGA-A1 epitope, a MART1 epitope, a MAGE-A3 epitope, or an SSX2 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
C07K 14/47 - Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from humans from vertebrates from mammals
C07K 14/74 - Major histocompatibility complex (MHC)
A61K 39/00 - Medicinal preparations containing antigens or antibodies
There is described herein a nanoparticle comprising an outer shell comprising a porphyrin salt, an expanded porphyrin salt or an analog of porphyrin salt, around an inner oil core.
The present disclosure is directed to methods of identifying MHC class II-specific T cell receptors (TCRs). In certain aspects, the method comprises contacting a T cell with a complex comprising an (i) MHC class II molecule having a higher affinity for CD4 than naturally occurring MHC class II molecules and (ii) a peptide, e.g., an epitope. In certain aspects, the HLA class II molecule comprises a beta chain having one or more mutations relative to a wild-type beta chain sequence.
G01N 33/569 - Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
G01N 33/554 - Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being a biological cell or cell fragment, e.g. bacteria, yeast cells
The present disclosure is directed to HLA class II molecules having a higher affinity for CD4 than naturally occurring HLA class II molecules. In certain aspects, the HLA class II molecule comprises a DR beta chain having (i) an amino acid other than leucine at a position corresponding to amino acid residue 114 of SEQ ID NO: 1, (ii) an amino acid other than valine at a position corresponding to amino acid residue 143 of SEQ ID NO: 1, (iii) or both (i) and (ii). Certain aspects of the present disclosure are directed to nucleic acid molecules encoding the HLA class II molecules, vectors comprising the nucleic acid molecule, cells comprising the same, and methods of use thereof.
The present disclosure is directed recombinant T cell receptors capable of binding a CCND1 epitope and nucleic acid molecules encoding the same. In some aspects, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some aspects, the methods comprise treating a cancer in a subject in need thereof.
A61P 35/04 - Antineoplastic agents specific for metastasis
C07K 16/30 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
The present disclosure relates to the development of methods for identifying cis-regulatory elements. Also disclosed herein are various methods including for example determining the tissue of origin of a biological sample, prognosis of a patient diagnosed with a cancer and their response to treatments.
The present disclosure is directed to HLA class II molecules having a higher affinity for CD4 than naturally occurring HLA class II molecules. In certain aspects, the HLA class II molecule comprises a DP beta chain having (i) an amino acid other than leucine at a position corresponding to amino acid residue 112 of SEQ ID NO: 1, (ii) an amino acid other than valine at a position corresponding to amino acid residue 141 of SEQ ID NO: 1, (iii) or both (i) and (ii). Certain aspects of the present disclosure are directed to nucleic acid molecules encoding the HLA class II molecules, vectors comprising the nucleic acid molecule, cells comprising the same, and methods of use thereof.
The present disclosure is directed to HLA class II molecules having a higher affinity for CD4 than naturally occurring HLA class II molecules. In certain aspects, the HLA class II molecule comprises a DQ beta chain having (i) an amino acid other than leucine at a position corresponding to amino acid residue 114 of SEQ ID NO: 1, (ii) an amino acid other than valine at a position corresponding to amino acid residue 143 of SEQ ID NO: 1, (iii) or both (i) and (ii). Certain aspects of the present disclosure are directed to nucleic acid molecules encoding the HLA class II molecules, vectors comprising the nucleic acid molecule, cells comprising the same, and methods of use thereof.
The present disclosure is directed recombinant T cell receptors capable of binding a MAGE-A2 epitope and nucleic acid molecules encoding the same. In some aspects, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some aspects, the methods comprise treating a cancer in a subject in need thereof.
A61P 35/04 - Antineoplastic agents specific for metastasis
C07K 16/30 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
The present disclosure is directed recombinant T cell receptors capable of binding a MUC5AC epitope and nucleic acid molecules encoding the same. In some aspects, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some aspects, the methods comprise treating a cancer in a subject in need thereof.
C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
The present application provides furosemide analogues of the general formula Z having activity as anti-Aβ aggregation agents and/or as inhibitors of Aβ induced neuroinflammation.
The present application provides furosemide analogues of the general formula Z having activity as anti-Aβ aggregation agents and/or as inhibitors of Aβ induced neuroinflammation.
The present application provides furosemide analogues of the general formula Z having activity as anti-Aβ aggregation agents and/or as inhibitors of Aβ induced neuroinflammation.
These compounds are useful in preventing, delaying and/or treating Alzheimer's Disease. Accordingly, the present application further provides pharmaceutical compositions and method for preventing, delaying and/or treating Alzheimer's Disease.
C07D 307/52 - Radicals substituted by nitrogen atoms not forming part of a nitro radical
C07D 413/12 - Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
C07D 333/22 - Radicals substituted by doubly bound hetero atoms, or by two hetero atoms other than halogen singly bound to the same carbon atom
C07C 229/56 - Compounds containing amino and carboxyl groups bound to the same carbon skeleton having amino and carboxyl groups bound to carbon atoms of six-membered aromatic rings of the same carbon skeleton with amino and carboxyl groups bound to carbon atoms of the same non-condensed six-membered aromatic ring with amino and carboxyl groups bound in ortho- position
C07D 277/28 - Radicals substituted by nitrogen atoms
C07D 405/12 - Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a chain containing hetero atoms as chain links
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
Various embodiments are described herein for creating a 3D human heart model for modelling arrythmias, wherein the method comprises seeding a structure with a mixture of human cardiomyocytes, cardiac fibroblasts and a fibrin mixture to form cardiac tissue; applying a plating media for settlement and compaction of the cardiac tissue; and adding an arrhythmogenic media to the cardiac tissue, where the arrhythmogenic media comprises methyl-beta cyclodextrin for disrupting calcium signaling.
An endoscopic imaging device is disclosed. The device includes a body portion configured to be held in a user's hand and an endoscope portion configured to direct light onto a target. At least one excitation light source is configured to excite autofluorescence emissions of tissue cells and fluorescence emissions of induced porphyrins in tissue cells of the target. A white light source is configured to illuminate the surgical margin during white light imaging of the target. The device also includes an imaging sensor and a first optical filter configured to filter optical signals emitted by the target responsive to illumination with excitation light and permit passage of autofluorescence emissions of tissue cells and fluorescence emissions of the induced porphyrins in tissue cells to the imaging sensor. A second optical filter configured to filter optical signals emitted by the target responsive to illumination with white light and permit passage of white light emissions of tissues in the surgical margin to the imaging sensor. The endoscopic imaging device may be modular and comprise a base body portion that releasably receives, in an interchangeable fashion, one or more endoscopic optical housing portions.
A61B 1/04 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor combined with photographic or television appliances
A61B 1/00 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor
A61B 1/06 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor with illuminating arrangements
A61B 1/05 - Instruments for performing medical examinations of the interior of cavities or tubes of the body by visual or photographical inspection, e.g. endoscopes; Illuminating arrangements therefor combined with photographic or television appliances characterised by the image sensor, e.g. camera, being in the distal end portion
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
A61B 46/10 - Surgical drapes specially adapted for instruments
A61P 1/16 - Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
A multi-electrode implantable device for sensing cardiac signals and various methods for using the sensed cardiac signals are described herein. The multi-electrode device comprises a tetrahedral electrode cluster at a tip at a distal end of the lead/device; four electrodes embedded in the tetrahedral configuration; and four individual wires extending from the electrodes within the lead for receiving voltages sensed by the four electrodes. The methods can be used for deriving various physiological features that can be used in various ways including: diagnosing a physiological condition, efficient sensing of physiological signals, applying more efficient pacing by a pacemaker and indirect cardiac mapping. One or more of the physiological features may be used for applying appropriate treatment methods by a pacemaker/ICD or for applying cardiac ablation or cryofreezing.
Provided herein are enriched populations of ventricular compact cardiomyocytes and enriched populations of mature ventricular or atrial cardiomyocytes, as well as methods of generating the enriched cell populations and methods of using the enriched cell populations in regenerative cardiac cell therapies.
Described are methods of performing perfusion on a heart having a left atrium, a right atrium, a pulmonary artery. The methods are performed on a device configured for selectively performing perfusion in at least a Langendorff mode and a right-sided working mode. The methods include performing profusion on a heart in a right-side working mode of the device in which an aortic line is open, a left atrial line is closed, and a reservoir return line is closed.
CRYSTAL FORM S4 OF THE PLK4 INHIBITOR (1R,2S)-(E)-2-(3-(4-((CIS-2,6-DIMETHYLMORPHOLINO)METHYL)STYRYL)- 1 H-IMIDAZOL-6- YL)-5'-METHOXYSPIRO[CYCLOPROPANE-1,3'-INDOLIN]-2'-ONE FUMARATE
Disclosed is Crystal Form S4 of a fumarate salt of compound (I) represented by the following structural formula: (I) The molar ratio between compound (I) and fumaric acid is 1.0:1:0. Crystal Form S4, 5 characterized by an X-ray powder diffraction pattern which comprises peaks at 6.6°, 9.8°, 16.3°, 21.1°, 28.7°, and 30.2°±0.2 in 2θ.
Disclosed is Crystal Form S4 of a fumarate salt of compound (I) represented by the following structural formula: (I) The molar ratio between compound (I) and fumaric acid is 1.0:1:0. Crystal Form S4, 5 characterized by an X-ray powder diffraction pattern which comprises peaks at 6.6°, 9.8°, 16.3°, 21.1°, 28.7°, and 30.2°±0.2 in 2θ.
C07D 413/14 - Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
A system and method for providing and managing a remote patient monitoring (RPM) system. The method is implemented by a central server, an RPM client, and a networked monitoring device. The RPM client is a software program that is executed by a computing device that is connected to the server via a network. The networked monitoring device is implemented as a locator or a smart mobile cart. More specifically, the RPM system can provide a tele-monitor with the ability to remotely monitor multiple patients, control remote cameras, and address abnormal patient situations. The RPM system can enhance tele-monitor effectiveness by detecting patient motion and tracking tele-monitor alertness.
G16H 40/67 - ICT specially adapted for the management or administration of healthcare resources or facilities; ICT specially adapted for the management or operation of medical equipment or devices for the operation of medical equipment or devices for remote operation
G16H 40/20 - ICT specially adapted for the management or administration of healthcare resources or facilities; ICT specially adapted for the management or operation of medical equipment or devices for the management or administration of healthcare resources or facilities, e.g. managing hospital staff or surgery rooms
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
A61B 5/11 - Measuring movement of the entire body or parts thereof, e.g. head or hand tremor or mobility of a limb
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
G06V 20/52 - Surveillance or monitoring of activities, e.g. for recognising suspicious objects
G06V 10/25 - Determination of region of interest [ROI] or a volume of interest [VOI]
G06V 10/28 - Quantising the image, e.g. histogram thresholding for discrimination between background and foreground patterns
G06V 10/44 - Local feature extraction by analysis of parts of the pattern, e.g. by detecting edges, contours, loops, corners, strokes or intersections; Connectivity analysis, e.g. of connected components
G06V 10/70 - Arrangements for image or video recognition or understanding using pattern recognition or machine learning
H04N 5/232 - Devices for controlling television cameras, e.g. remote control
G06F 3/01 - Input arrangements or combined input and output arrangements for interaction between user and computer
G06F 40/58 - Use of machine translation, e.g. for multi-lingual retrieval, for server-side translation for client devices or for real-time translation
The present disclosure is directed recombinant T cell receptors capable of binding a gp100 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
The present disclosure is directed recombinant T cell receptors capable of binding an NY-ESO-1 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
The present disclosure is directed recombinant T cell receptors capable of binding an NY-ESO-1 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
A61K 39/00 - Medicinal preparations containing antigens or antibodies
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
A61K 31/675 - Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
C07K 16/30 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
The present disclosure is directed recombinant T cell receptors capable of binding a gp100 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
The present disclosure is directed recombinant T cell receptors capable of binding a gp100 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
C07K 14/74 - Major histocompatibility complex (MHC)
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
C12N 15/62 - DNA sequences coding for fusion proteins
The invention provides novel anti-TSG-6 antibodies, pharmaceutical compositions comprising such antibodies, and therapeutic methods of using such antibodies and pharmaceutical compositions for the treatment of diseases such as cancer or autoimmune disease.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
The present disclosure is directed recombinant T cell receptors capable of binding an NY-ESO-1 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
The present disclosure is directed recombinant T cell receptors capable of binding an gp100 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
A61K 31/675 - Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
A61K 31/375 - Ascorbic acid, i.e. vitamin C; Salts thereof
A61K 31/436 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
C07K 14/74 - Major histocompatibility complex (MHC)
A61K 39/00 - Medicinal preparations containing antigens or antibodies
Various embodiments are described herein for a device, system and method for delivering deep brain stimulation of a target structure. A target model corresponding to the target structure is used where the model includes a neuronal model for modeling one or more neurons of the target structure and a short-term plasticity model for modeling temporal behaviour of the neuron in response to one or more stimulus pulses over time. The method generally includes receiving input data related to the target structure including a brain region of the target structure, stimulus parameters including pulse frequency, and model parameters that correspond to the brain structure; determining a neuronal response of the target structure by applying the stimulus parameters and the model parameters to the target model; and performing any combination of outputting the neuronal response, storing the neuronal response and transmitting the neuronal response to another device.
Board of Regents, The University of Texas System (USA)
University Health Network (Canada)
Inventor
Andreeff, Michael
Ishizawa, Jo
Schimmer, David
Zarabi, Sara
Abstract
Provided herein are methods of using ClpP levels and mutation status as a marker for the selection and treatment of cancer patients who will respond to the administration of imipridones. Also provided are methods of treating patients having Perrault syndrome. Also provided are methods of killing bacterial cells and treating bacterial infections using imipridones.
A61K 31/519 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
A61K 31/635 - Compounds containing para-N-benzene- sulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonohydrazide having a heterocyclic ring, e.g. sulfadiazine
The present disclosure relates to a method for patient-specific optimization of imaging protocols. According to an embodiment, the present disclosure relates to a method for generating a patient-specific imaging protocol, comprising acquiring scout scan data, the scout scan data including scout scan information and scout scan parameters, generating a simulated image based on the acquired scout scan data, deriving a simulated dose map from the generated simulated image, determining image quality of the generated simulated image by applying machine learning to the generated simulated image, the neural network being trained to generate at least one probabilistic quality representation corresponding to at least one region of the generated simulated image, evaluating the determined image quality relative to a image quality threshold and the derived simulated dose map relative to a dosage threshold, optimizing. based on the evaluating, scan acquisition parameters and image reconstruction parameters, and generating, optimal imaging protocol parameters, wherein the optimal imaging protocol parameters maximize image quality while minimizing radiation exposure.
G16H 30/20 - ICT specially adapted for the handling or processing of medical images for handling medical images, e.g. DICOM, HL7 or PACS
G06N 3/04 - Architecture, e.g. interconnection topology
G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
86.
Multi-Modal System for Visualization and Analysis of Surgical Specimens
The present disclosure provides methods, systems, and devices for coregistering imaging data to form three-dimensional superimposed images of target such as a tumor or a surgical bed. A three-dimensional map can be generated by projecting infrared radiation at a target area, receiving reflected infrared radiation, and measuring depth of the target area. A three-dimensional white light image can be created from a captured two-dimensional white light image and the three-dimensional map. A three-dimensional fluorescence image can be created from a captured two-dimensional fluorescence image and the three-dimensional map. The three-dimensional white light image and the three-dimensional fluorescence image can be aligned using one or more fiducial markers to form a three-dimensional superimposed image. The superimposed image can be used to excise cancerous tissues, for example, breast tumors. Images can be in the form of videos.
An imaging device includes a body having a first end portion configured to be held in a user's hand and a second end portion configured to direct light onto a surgical margin. The device includes at least one excitation light source configured to excite autofluorescence emissions of tissue cells and fluorescence emissions of induced porphyrins in tissue cells of the surgical margin. A white light source is configured to illuminate the surgical margin during white light imaging of the surgical margin. The device includes an imaging sensor, a first optical filter configured to permit passage of autofluorescence emissions of tissue cells and fluorescence emissions of the induced porphyrins in tissue cells to the imaging sensor, and a second optical filter configured to permit passage of white light emissions of tissues in the surgical margin to the imaging sensor. Systems and methods relate to imaging devices.
The invention provides novel anti-LILRB3 antibodies, pharmaceutical compositions comprising such antibodies, and therapeutic methods of using such antibodies and pharmaceutical compositions for the treatment of diseases such as cancer, autoimmune disease, or allergic inflammation This invention can also be used to modulate osteoclast differentiation.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
89.
SYSTEMS, METHODS, AND DEVICES FOR THREE-DIMENSIONAL IMAGING, MEASUREMENT, AND DISPLAY OF WOUNDS AND TISSUE SPECIMENS
The present disclosure provides methods, systems, and devices for coregistering imaging data to form three-dimensional superimposed images of a biological target such as a wound, a tumor, or a surgical bed. A three-dimensional map can be generated by projecting infrared radiation at a target area, receiving reflected infrared radiation, and measuring depth of the target area. A three-dimensional white light image can be created from a captured two-dimensional white light image and the three-dimensional map. A three-dimensional fluorescence image can be created from a captured two-dimensional fluorescence image and the three-dimensional map. The three-dimensional white light image and the three-dimensional fluorescence image can be aligned using one or more fiducial markers to form a three-dimensional superimposed image. The superimposed image can be used to track wound healing and to excise cancerous tissues, for example, breast tumors. Images can be in the form of videos.
The invention provides novel anti-FCMR antibodies, pharmaceutical compositions comprising such antibodies, and therapeutic methods of using such antibodies and pharmaceutical compositions for the treatment of diseases such as cancer or autoimmune disease.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A61P 35/02 - Antineoplastic agents specific for leukemia
C12N 15/63 - Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
The present invention relates to a novel co-crystal of the compound of formula (I):
wherein the co-former molecule is bisphosphate hemihydrate, to processes for the preparation of the co-crystal, to pharmaceutical compositions containing the co-crystal, to the use of such a co-crystal in the manufacture of a medicament for use in the treatment of cancer and to methods of treating such diseases in the human or animal body by administering a therapeutically effective amount of such a co-crystal.
C30B 7/14 - Single-crystal growth from solutions using solvents which are liquid at normal temperature, e.g. aqueous solutions the crystallising materials being formed by chemical reactions in the solution
C30B 7/02 - Single-crystal growth from solutions using solvents which are liquid at normal temperature, e.g. aqueous solutions by evaporation of the solvent
A tissue phantom is disclosed. The tissue phantom includes a first portion having the optical properties of healthy tissue and a second portion having the optical properties of cancerous tissue. Additionally, a method of calibrating an optical instrument is disclosed. The method includes illuminating a tissue phantom with excitation light from the optical instrument, detecting optical emissions emitted by the tissue phantom in response to illumination with the excitation light, and calibrating the optical instrument based upon the detected fluorescence.
Described are methods for the production and use of cryopreservable double negative T cells (DNTs) for the treatment of cancer as an off-the-shelf cellular therapy. A sample population of DNTs is expanded using DNTs from one or more donors. The expanded population of DNTs from different donors does not exhibit alloreactivity against allogenic cells in the expanded population. The expanded populations of DNTs can be long-term stored as cryopreserved products.
A61K 35/15 - Cells of the myeloid line, e.g. granulocytes, basophils, eosinophils, neutrophils, leucocytes, monocytes, macrophages or mast cells; Myeloid precursor cells; Antigen-presenting cells, e.g. dendritic cells
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A61K 35/28 - Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
94.
Device and method for determining depth and concentration of a subsurface fluorescent object
A method and device for determining the depth and fluorophore concentration of a fluorophore concentration below the surface of an optically absorbing and scattering medium suitable for use in fluorescence-based surgical guidance such as in tumor resection is described. Long-wavelength stimulus light us used to obtain deep tissue penetration. Recovery of depth is performed by fitting measured modulation amplitudes for each spatial frequency to precomputed modulation amplitudes in a table of modulation amplitudes indexed by optical parameters and depth.
A system for fluorescence-based imaging of a target includes at least one excitation light source configured to emit a homogeneous field of excitation light and positioned to uniformly illuminate a target surface with the homogeneous field of excitation light during fluorescent imaging, a power source, and a portable housing configured to be held in a user's hand during imaging. The housing contains a lens, a filter, an image sensor, and a processor. The filter is configured to permit optical signals responsive to illumination of the target surface and having a wavelength corresponding to at least one of bacterial autofluorescence and tissue autofluorescence to pass through the filter to the image sensor. The at least one excitation light is adjacent to the housing so as to be positioned between the target surface and the image sensor during fluorescent imaging.
A method of screening for contamination during food production is disclosed. The method includes applying an exogenous, bacteria-specific contrast agent to a surface to be screened, wherein the surface to be screened is one or more of a food product, a food-preparation surface, a food-handling surface, and a food-equipment surface. The surface is illuminated with excitation light emitted by at least one light excitation light source of a handheld device and optical signals responsive to illumination of the surface are filtered with at least one optical filter of the handheld device. Bacterial fluorescence data regarding the illuminated surface is collected with an image sensor of the handheld device and, in real-time, based on the collected bacterial fluorescence data, the presence and/or location of bacteria on the illuminated surface is determined
Disclosed herein are methods of producing a population of venous angioblast cells from stem cells using a venous angioblast inducing media and optionally isolating a CD34+ population from the cell population comprising the venous angioblast cells, for example using a CD34 affinity reagent, CD31 affinity reagent and/or CD144 affinity reagent, optionally with or without a CD73 affinity reagent as well as methods of further differentiating the venous angioblasts in vitro to produce SEC-LCs and/or in vivo to produce SECs. Uses of the cells and compositions comprising the cells are also described.
Various embodiments are described herein of radiation systems and methods for monitoring radiation dose are provided monitoring an amount of radiation in a radiation beam generated by a radiation source for a radiation treatment session, where a radiation sensor is used to provide an actual radiation measurement and an Artificial Neural Network (ANN) engine is used to generate a predicted radiation measurement based on a plurality of feature values for features including radiation field segments from the radiation treatment plan data for the radiation treatment session. The difference between the actual radiation measurement and the predicted radiation measurement is used to determine whether the radiation system is operating in a predetermined safe operation range.
G06N 3/04 - Architecture, e.g. interconnection topology
G16H 20/40 - ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to mechanical, radiation or invasive therapies, e.g. surgery, laser therapy, dialysis or acupuncture
Thienopyridinone compounds of Formula (I) and pharmaceutically acceptable salts thereof are described. In these compounds, one of X1; X2, and X3 is S and the other two are each independently CR, wherein R and all other variables are as defined herein. The compounds are shown to inhibit HPK1 kinase activity and to have in vivo antitumor activity. The compounds can be effectively combined with pharmaceutically acceptable carriers and also with other immunomodulatory approaches, such as a checkpoint inhibition or inhibitors of tryptophan oxidation. Formula (I).
Thienopyridinone compounds of Formula (I) and pharmaceutically acceptable salts thereof are described. In these compounds, one of X1; X2, and X3 is S and the other two are each independently CR, wherein R and all other variables are as defined herein. The compounds are shown to inhibit HPK1 kinase activity and to have in vivo antitumor activity. The compounds can be effectively combined with pharmaceutically acceptable carriers and also with other immunomodulatory approaches, such as a checkpoint inhibition or inhibitors of tryptophan oxidation. Formula (I).
A61K 31/496 - Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A61K 31/4355 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having oxygen as a ring hetero atom
A61K 31/5355 - Non-condensed oxazines containing further heterocyclic rings
A61K 31/551 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogens as ring hetero atoms, e.g. clozapine, dilazep
A method comprising obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; and detecting a presence of or measuring a level of novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4). Also provided are methods where additional miRNAs are detected including novel miRNA 5 (SEQ ID NO: 5), novel miRNA 6 (SEQ ID NO: 6), novel miRNA 7 (SEQ ID NO: 7), novel miRNA 8 (SEQ ID NO: 8), novel miRNA 9 (SEQ ID NO: 9), novel miRNA 10 (SEQ ID NO: 10), novel miRNA 11 (SEQ ID NO: 11), novel miRNA 12 (SEQ ID NO: 12), novel miRNA 13 (SEQ ID NO: 13), hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191-3p, hsa-miR-335-5p and/or hsa-miR-543.
patents
