Recent literature on SARS-CoV-2 pathogenesis has suggested that the induction of substantial acute respiratory distress phenotypes is driven by a mismatched inflammatory response together with broad vascular dysfunction. While several detailed reports implementing multi-omic approaches have provided insight into the immune cell phenotypes involved in these processes, risk stratifying markers specific to COVID-19 and the vasculature have not been explored. Provided herein is a comprehensive, multi-omics-based description of the molecular antecedents to COVID-19 mortality, yielding new insights pertaining to the vasculature while highlighting the urgent need for clinical translation of novel biomarkers for disease prognosis.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
There is described herein a method for predicting response to anti-PD1 based therapy in a subject with cancer, the method comprising: providing a sample of peripheral blood from the subject; adding an IFN-I to the sample; assessing T-cell response to IFN-I stimulation in the peripheral blood sample by measuring the expression of IFN-I stimulated genes; and predicting a better outcome in response to anti-PD1 therapy if the assessment in the previous step indicates T-cell resistance to IFN-I stimulation and predicting a poorer outcome in response to anti-PD1 therapy if the assessment step indicates T-cell responsiveness to IFN-I stimulation.
The present disclosure is directed to methods of treating a subject in need thereof, comprising administering to the subject a population of modified immune cells, which comprises one or more modified immune cells having decreased expression of one or more components of the SAGA (Spt?Ada?Gcn5?acetyltransferase) complex, relative to an unmodified immune cell. In some aspects, the immune cell comprises a chimeric antigen receptor or a T cell receptor. In some aspects, the immune cell is a T cell, an NK cell, or a tumor infiltrating lymphocyte (TIL).
There is described herein a method of predicting treatment response to a drug in a patient with leukemia, wherein the drug had been predetermined to preferentially target either primitive or mature leukemic cells, the method comprising: determining a primitiveness score using at least 3 genes in a test sample from the subject selected from the group consisting of DNMT3B, ZBTB46, NYNRIN, ARHGAP22, LAPTM4B, MMRN1, DPYSL3, KIAA0125, CDK6, CPXM1, SOCS2, SMIM24, EMP1, NGFRAP1, CD34, AKR1C3, and GPR56.
C12Q 1/6883 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
G16H 20/10 - ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to drugs or medications, e.g. for ensuring correct administration to patients
G16B 20/00 - ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
G16B 25/10 - Gene or protein expression profiling; Expression-ratio estimation or normalisation
G16B 40/00 - ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
C40B 30/04 - Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
Methods, kits and devices for assessing bile acid in a donor lung and/or a transplant recipient are described. The methods involve obtaining from the donor lung or transplant recipient a bronchial wash sample, optionally a bronchoalveolar lavage (BAL) sample or a large airway bronchial wash (LABW) sample; measuring in the bronchial wash sample the level of bile acid and optionally one or more inflammation markers, comparing biomarker levels with a control or cut-off level, wherein a differential biomarker level is indicative of an outcome of the donor lung or transplant recipient, including risk of aspiration, suitability of the donor lung, or risk of a particular outcome in the transplant recipient.
Disclosed herein are methods and compositions for treatment, prognosis, and diagnosis of cancer, including prostate cancer. Aspects of the disclosure are directed to methods for a subject having prostate cancer determined to have ZNRF3 genomic loss, reduced ZNRF3 expression, and/or increased ZNRF3 methylation. Also disclosed are methods for analysis of tumor DNA for ZNRF3 copy number status, expression, and/or methylation, as well as compositions and kits useful for such analysis.
C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
C12Q 1/6809 - Methods for determination or identification of nucleic acids involving differential detection
The present disclosure relates generally to neural progenitor cells and therapeutic uses thereof. More particularly, the present disclosure provides cervical spinal cord-specific neural progenitor cells (cerNPCs), methods of producing cerNPCs, pharmaceutical compositions comprising cerNPCs, and methods of treating neurological diseases or disorders with the cerNPCs.
A61P 25/00 - Drugs for disorders of the nervous system
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
Various embodiments are described herein for a system, method, and device for automated detection of focal source locations of electrophysiological activity in an organ. The system, method and device may also be used to guide catheter 5 ablation of the organ. An electrogram signal can be obtained from a location in the organ, and it can be determined if the electrogram is periodic. If so, the corresponding unipolar electrogram can be input to a deep learning neural network classification model trained to generate a unipolar electrogram classification result in response to receiving the unipolar electrogram as an input. The location can be identified as a focal 10 source location or a non-focal source location based on the unipolar electrogram classification result.
There is described herein a bilayer nanovesicle comprising porphyrin-phospholipid conjugate and a chelator-fatty acid conjugate; wherein the chelator-fatty acid conjugate comprises an aminopolycarboxylic acid conjugated to a single chain fatty acid; and the porphyrin-phospholipid conjugate comprises one porphyrin, porphyrin derivative or porphyrin analog covalently attached to a lipid side chain, preferably at the sn-1 or the sn-2 position, of one phospholipid.
A61K 47/54 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
A61K 47/69 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
A61K 51/12 - Preparations containing radioactive substances for use in therapy or testing in vivo characterised by a special physical form, e.g. emulsion, microcapsules, liposomes
10.
CARDIOMYOCYTE SUBTYPES AND METHODS OF MAKING AND USING
Cardiomyocyte subtypes, including first heart field (FHF) and second heart field(SHF) (e.g., anterior second heart field (aSHF) and posterior second heart field (pSHF)) cells,and methods of making and using such cells, are described.
Provided is a lung preservation composition comprising a non-carbonic buffered nutrient media, preferably a phosphate buffered nutrient media, and a dextran, optionally Dextran 40 and and optionally prostaglandin E1 (PGE1), and optionally at least one of alpha 1 antitrypsin (A1AT), an impermeant, optionally raffinose, an antioxidant, optionally glutathione, and necrostatin-1. Also described is a method of preserving a lung prior to and/or during transplant using said lung preservation composition, and kits comprising one or more components of the lung preservation composition.
The present disclosure relates generally to epigenetically and genetically modified organs and tissues and methods of producing same. In particular, the present disclosure is directed to organs and tissues that have been epigenetically and/or genetically modified at one or multiple loci to control inflammation-regulating or immune-regulating gene expression and thereby improve the condition of the organs and tissues.
C12N 15/85 - Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
C12N 5/071 - Vertebrate cells or tissues, e.g. human cells or tissues
C12N 15/113 - Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides
A61K 31/7105 - Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
A61K 35/12 - Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
Described herein are methods and compositions for screening cancer cells for sensitivity to itraconazole and use of itraconazole in treatment of cancer.
Devices, methods of using devices, and methods of training devices are provided. For example, a portable, hand-held device comprises: a sensor configured to record surface electromyography (sEMG) data for at least one muscle; a memory; and a processor configured to apply predetermined relationships between the sEMG data and reference data stored in the memory, and based on the relationships, generate a predicted recovery profile for the muscle. The device may implement algorithms trained in a functional electrical stimulation therapy (FES-T) program and/or may be used for predicting muscle recovery in the FES-T program.
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
Provided are methods, systems, and devices for preserving donor organs using a technique that includes alternating between static cold storage and ex vivo organ perfusion. For example, methods for preserving a donor organ can comprise refrigerating a donor organ to form a once-refrigerated donor organ, perfusing the once-refrigerated donor organ to form a once-perfused donor organ, and refrigerating the once-perfused donor organ to form a preserved, twice-refrigerated donor organ for transplantation.
The invention provides novel anti-LILR antibodies, pharmaceutical compositions comprising such antibodies, and therapeutic methods of using such antibodies and pharmaceutical compositions for the treatment of diseases such as cancer, autoimmune disease, or allergic inflammation.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
There is described herein a method for improving the anti-cancer properties of T-cells, the method comprising: providing a population of T-cells; and culturing the T-cells in an environment that activates the GCN2 pathway.
C12N 5/0783 - T cells; NK cells; Progenitors of T or NK cells
A61K 31/517 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
C07D 401/06 - Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a carbon chain containing only aliphatic carbon atoms
C12N 5/10 - Cells modified by introduction of foreign genetic material, e.g. virus-transformed cells
18.
IMMUNOGLOBULIN LIGHT CHAIN ANTIBODIES AND USES THEREOF
The present disclosure is directed to antibodies or antigen-binding portions thereof that specifically bind free immunoglobulin light chains (FLC), polynucleotides and vectors encoding the same, and pharmaceutical compositions comprising the same. Some aspects of the disclosure are directed to methods of measuring FLC in a biological sample comprising contacting the sample with the anti-FLC antibody. Some aspects of the disclosure are directed to methods of treating a disease or condition comprising administering the anti-FLC antibody to a subject in need thereof.
Disclosed herein are methods for treating a neurodegenerative disease and/or an optic nerve, brain and/or spinal cord injury using a Ndfip1 fusion polypeptide, a Ndfip1 nucleic acid molecule, a construct or expression cassette comprising the Ndfip1 nucleic acid molecule, and a cell comprising the construct and/or expression the fusion polypeptide.
A61K 47/66 - Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid the modifying agent being a pre-targeting system involving a peptide or protein for targeting specific cells
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
C07K 14/145 - Rhabdoviridae, e.g. rabies virus, Duvenhage virus, Mokola virus or vesicular stomatitis virus
Provided is a fixative composition comprising from at least 5 percent to 50 percent syrup, optionally honey, preferably, at least 10 syrup, and dextran and optionally coconut oil, optionally from at least 10g/L to about 60 g/L of dextran, preferably about 50 g/L and/or from at least 0.5 percent to 15 percent coconut oil, preferably at least 1 percent coconut oil, methods of making the solution, methods of using the solution, for example methods for preserving a biological sample in said solution, and containers and kits comprising the solution.
Provided herein are methods of producing spNPCs from iPSCs or NPCs, cell populations, compositions comprising cell populations, and uses of spNPCs made using the methods described. The method can comprise: a. obtaining unpatterned NPCs, the unpatterned NPCs expressing neuroectodermal markers including Pax6 and Sox1; b. priming the unpatterned NPCs of step a; and c. patterning the primed unpatterned NPCs to produce spNPCS.
A61P 25/00 - Drugs for disorders of the nervous system
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
22.
MULTIMODAL ANALYSIS OF CIRCULATING TUMOR NUCLEIC ACID MOLECULES
In an aspect, there is provided a method of detecting the presence of ctDNA from cancer cells in a subject comprising: (a) providing a sample of cell-free DNA from a subject; (b) subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA; (c) optionally adding a first amount of filler DNA to the sample, wherein at least a portion of the filler DNA is methylated, then further optionally denaturing the sample; (d) capturing cell-free methylated DNA using a binder selective for methylated polynucleotides; (e) sequencing the captured cell-free methylated DNA; (f) comparing the sequences of the captured cell-free methylated DNA to control cell-free methylated DNAs sequences from healthy and cancerous individuals; (g) identifying the presence of DNA from cancer cells if there is a statistically significant similarity between one or more sequences of the captured cell-free methylated DNA and cell-free methylated DNAs sequences from cancerous individuals; wherein in at least one of the capturing step, the comparing step or the identifying step, the subject cell-free methylated DNA is limited to a sub-population according to a fragment length metric.
C12Q 1/6809 - Methods for determination or identification of nucleic acids involving differential detection
C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
G16B 20/00 - ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
G16B 30/00 - ICT specially adapted for sequence analysis involving nucleotides or amino acids
C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
23.
IMMUNOGENIC RETROELEMENTS AND THEIR USE IN CANCER THERAPY
There is described herein a method of assessing a subject's responsiveness to cancer therapy, comprising: providing a sample from the subject comprising cancers cells or suspected cancer cells; measuring or estimating the expression levels of inverted repeats (IR) Alus in the cells; and determining that the subject would be responsive to 5 cancer therapy if the subject cells exhibit expression levels of inverted repeats (IR) Alus with reference to expression levels in control samples.
A method staging of knee osteoarthritis (OA) comprising a) obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; b) detecting a presence of or measuring a level of one or more miRNAs selected from hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191- 3p, hsa-miR- 335-5p, hsa-miR-543, novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4); and c) identifying the subject as likely to have early stage osteoarthritis or late stage osteoarthritis based on the presence of or measured level of the one or more miRNAs. Isolated nucleic acids, primers, probes, panels and kits are also provided.
Methods and compositions of whole cell vaccines for delivering immune modulatory molecules IL-12 and at least one of IL-21 and/or IL-18 to result in a therapeutic effect are disclosed. The methods and compositions use stably integrating lentiviral delivery systems. The methods are useful for therapeutically and prophylactically treating cancer such as leukemia.
A novel salt form of Compound (I) represented by the following structural formula, and its corresponding pharmaceutical compositions, are disclosed. (I), Particular single crystalline forms of 1:1 Compound (I) tartrate salt are characterized by a variety of properties and physical measurements. Methods of preparing specific crystalline forms are also disclosed. The present disclosure also provides methods of treating cancer in a subject.
A61K 31/194 - Carboxylic acids, e.g. valproic acid having two or more carboxyl groups, e.g. succinic, maleic or phthalic acid
A61K 31/4365 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system having sulfur as a ring hetero atom, e.g. ticlopidine
A61P 9/00 - Drugs for disorders of the cardiovascular system
A61P 9/10 - Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
C12Q 1/02 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
C12Q 1/18 - Testing for antimicrobial activity of a material
Disclosed herein is a method of treating a subject with aberrant cytokine release from a disease or condition or at risk of developing aberrant cytokine release from a disease or condition. The method comprises administering to the subject an effective amount of a compound represented by structural formula (I): (I) or a pharmaceutically acceptable salt thereof. The variables in structural formula (I) are as described herein.
A61K 31/4436 - Non-condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a heterocyclic ring having sulfur as a ring hetero atom
COMPOSITIONS AND METHODS FOR ENHANCING ACTIVATION AND CYTOLYTIC ACTIVITY OF CD8+ T CELLS THROUGH DISRUPTION OF THE SAGA (SPT-ADA-GCN5-ACETYLTRANSFERASE) COMPLEX
Methods of increasing T cell effector function in a T cell population are provided that involve inhibiting one or more genetic subunits of the SAGA (Spt-Ada-Gcn5-acetyltransferase) gene regulation complex in the T cell population. Also provided are methods of using such T cell populations in the treatment of cancer patients.
A61K 31/7088 - Compounds having three or more nucleosides or nucleotides
A61K 31/7105 - Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
Provided herein are methods of treating triple negative breast cancer using an effective amount of Compound (I) represented by the formula: or a pharmaceutically acceptable salt thereof and an effective amount of an immune checkpoint inhibitor, wherein the checkpoint inhibitor is a PD-1 inhibitor or a PD-L1 inhibitor. Uses of an effective amount of Compound [I] and an effective amount of an immune checkpoint inhibitor, wherein the checkpoint inhibitor is a PD-1inhibitor or a PD-L1 inhibitor for treating triple negative breast cancer are also provided herein.
C07D 413/14 - Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
31.
METHODS, COMPOSITIONS, AND SYSTEMS FOR ENHANCING EX-VIVO ORGAN PERFUSION
An organ perfusion solution includes a colloid component, a salt mixture, a buffer system, and a glutamine compound in a physiologically acceptable medium.
The present application provides a method of treating a condition associated with coronavirus infection, the condition selected from acute respiratory distress, lung inflammation, systemic inflammation, or cytokine storm, the method comprising administration of furosemide or a pharmaceutically acceptable salt or hydrate thereof.
A61K 31/635 - Compounds containing para-N-benzene- sulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonohydrazide having a heterocyclic ring, e.g. sulfadiazine
The disclosure relates to the development and use of CD4- CD8- double negative T (DNT) cells genetically modified to bind to one or more target antigens to enhance DNT cell anti-cancer activity such as with a chimeric antigen receptor (CAR). Genetically modified DNT cells can be generated ex vivo and expanded from allogeneic healthy donor cells and used as off-the-shelf therapy to overcome allogeneic graft-versus-host disease (GvHD) and/or host-versus-graft rejection in the treatment of cancer.
The invention is related to a method of treating a subject with acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, non-Hodgkin's lymphoma, Burkitt lymphoma, or diffuse large B-cell lymphoma, or myelodysplastic syndrome by administration of Compound (I): (I), or a pharmaceutically acceptable salt thereof.
C07D 413/14 - Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
35.
SYNTHETIC SPIKE-IN CONTROLS FOR CELL-FREE MEDIP SEQUENCING AND METHODS OF USING SAME
There is described herein, a method of capturing and analyzing cell-free methylated DNA in a sample. The method involves subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA. A predetermined amount of control synthetic DNA fragments are added to the sample. The control synthetic DNA fragments each have a known nucleic acid sequence that does not align to a target genome sequence, and at least some of the control synthetic DNA fragments are methylated. The sample is denatured, and cell-free methylated DNA and the control synthetic DNA fragments are captured using a binder selective for methylated polynucleotides. The captured DNA is amplified and sequenced.
There is described herein a cell culture medium comprising: a basal medium; an antibiotic; B27; Noggin; Y-27632; Human FGF10 or FGF7; preferably wherein there is an absence of a Wnt agonist. Methods and uses of the medium is also described.
There is described herein a method for capturing circulating tumor DNA (ctDNA) of interest from an animal sample, preferably a mammalian sample, further preferably a human patient sample, comprising cell-free DNA (cfDNA), the method comprising: adding to the patient sample a library of nucleic acid hybrid capture probes, wherein the library of 5 probes is complementary to both strands of the double stranded ctDNA of interest and the probes are tagged for capture; allowing the probes to hybridize to the ctDNA; and capturing the hybridized ctDNA using the tag on the probes. Libraries of probes for use with these methods are also described.
C12N 15/10 - Processes for the isolation, preparation or purification of DNA or RNA
C12Q 1/70 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
C40B 30/04 - Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
The present disclosure is directed to HLA class II molecules having a higher affinity for CD4 than naturally occurring HLA class II molecules. In certain aspects, the HLA class II molecule comprises a DQ beta chain having (i) an amino acid other than leucine at a position corresponding to amino acid residue 114 of SEQ ID NO: 1, (ii) an amino acid other than valine at a position corresponding to amino acid residue 143 of SEQ ID NO: 1, (iii) or both (i) and (ii). Certain aspects of the present disclosure are directed to nucleic acid molecules encoding the HLA class II molecules, vectors comprising the nucleic acid molecule, cells comprising the same, and methods of use thereof.
The present disclosure is directed to HLA class II molecules having a higher affinity for CD4 than naturally occurring HLA class II molecules. In certain aspects, the HLA class II molecule comprises a DR beta chain having (i) an amino acid other than leucine at a position corresponding to amino acid residue 114 of SEQ ID NO: 1, (ii) an amino acid other than valine at a position corresponding to amino acid residue 143 of SEQ ID NO: 1, (iii) or both (i) and (ii). Certain aspects of the present disclosure are directed to nucleic acid molecules encoding the HLA class II molecules, vectors comprising the nucleic acid molecule, cells comprising the same, and methods of use thereof.
The present disclosure is directed recombinant T cell receptors capable of binding a CCND1 epitope and nucleic acid molecules encoding the same. In some aspects, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some aspects, the methods comprise treating a cancer in a subject in need thereof.
The present disclosure is directed recombinant T cell receptors capable of binding a MAGE-A2 epitope and nucleic acid molecules encoding the same. In some aspects, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some aspects, the methods comprise treating a cancer in a subject in need thereof.
The present disclosure is directed to HLA class II molecules having a higher affinity for CD4 than naturally occurring HLA class II molecules. In certain aspects, the HLA class II molecule comprises a DP beta chain having (i) an amino acid other than leucine at a position corresponding to amino acid residue 112 of SEQ ID NO: 1, (ii) an amino acid other than valine at a position corresponding to amino acid residue 141 of SEQ ID NO: 1, (iii) or both (i) and (ii). Certain aspects of the present disclosure are directed to nucleic acid molecules encoding the HLA class II molecules, vectors comprising the nucleic acid molecule, cells comprising the same, and methods of use thereof.
The present disclosure is directed to methods of identifying MHC class II-specific T cell receptors (TCRs). In certain aspects, the method comprises contacting a T cell with a complex comprising an (i) MHC class II molecule having a higher affinity for CD4 than naturally occurring MHC class II molecules and (ii) a peptide, e.g., an epitope. In certain aspects, the HLA class II molecule comprises a beta chain having one or more mutations relative to a wild-type beta chain sequence.
The present disclosure is directed recombinant T cell receptors capable of binding a MUC5AC epitope and nucleic acid molecules encoding the same. In some aspects, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some aspects, the methods comprise treating a cancer in a subject in need thereof.
Provided herein are methods for large-scale in vitro maturation of cardiomyocytes derived from human pluripotent stem cells, compositions prepared by these methods, and use of these compositions in cardiac regeneration.
A61P 9/00 - Drugs for disorders of the cardiovascular system
A61P 9/10 - Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
A61P 1/16 - Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
C12N 5/00 - Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
47.
SYSTEM AND METHOD FOR FILTERING TIME-VARYING DATA FOR PHYSIOLOGICAL SIGNAL PREDICTION
THE GOVERNING COUNCIL OF THE UNIVERSITY OF TORONTO (Canada)
UNIVERSITY HEALTH NETWORK (Canada)
Inventor
Gershon, Andrea
Liaqat, Daniyal
Abdalla, Mohamed
De Lara, Eyal
Rudzicz, Frank
Wu, Robert
Abstract
Systems and methods for filtering time-varying data for filtering and extracting a predicted physiological signal. A method including: segmenting the time-varying data into temporal windows; using a trained filter machine learning model, predicting an error for each prediction of the physiological signal for each window of time-varying data, the filter machine learning model trained using physiological signal predictions based on training time-varying data and known values of the physiological signal for the training time-varying data; discarding each window of time-varying data when the predicted error for such window is greater than a threshold; and where the window of time-varying data is not discarded, outputting at least one of the window of time-varying data and the predicted error for each prediction of the physiological signal.
G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
There is described herein a nanoparticle comprising an outer shell comprising a porphyrin salt, an expanded porphyrin salt or an analog of porphyrin salt, around an inner oil core.
A61K 31/337 - Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
A61K 41/00 - Medicinal preparations obtained by treating materials with wave energy or particle radiation
A61K 47/44 - Oils, fats or waxes according to two or more groups of ; Natural or modified natural oils, fats or waxes, e.g. castor oil, polyethoxylated castor oil, montan wax, lignite, shellac, rosin, beeswax or lanolin
C07D 305/14 - Heterocyclic compounds containing four-membered rings having one oxygen atom as the only ring hetero atoms condensed with carbocyclic rings or ring systems
C07D 487/22 - Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups in which the condensed system contains four or more hetero rings
Provided herein are enriched populations of ventricular compact cardiomyocytes and enriched populations of mature ventricular or atrial cardiomyocytes, as well as methods of generating the enriched cell populations and methods of using the enriched cell populations in regenerative cardiac cell therapies.
A multi-electrode implantable device for sensing cardiac signals and various methods for using the sensed cardiac signals are described herein. The multi-electrode device comprises a tetrahedral electrode cluster at a tip at a distal end of the lead/device; four electrodes embedded in the tetrahedral configuration; and four individual wires extending from the electrodes within the lead for receiving voltages sensed by the four electrodes. The methods can be used for deriving various physiological features that can be used in various ways including: diagnosing a physiological condition, efficient sensing of physiological signals, applying more efficient pacing by a pacemaker and indirect cardiac mapping. One or more of the physiological features may be used for applying appropriate treatment methods by a pacemaker/ICD or for applying cardiac ablation or cryofreezing.
A61N 1/365 - Heart stimulators controlled by a physiological parameter, e.g. by heart potential
51.
CRYSTAL FORM S4 OF THE PLK4 INHIBITOR (IR,2S)-(E)-2-(3-(4-((CIS-2,6-DIMETHYLMORPHOLINO)METHYL)STYRYL)- 1 H-IMIDAZOL-6-YL)-5'-METHOXYSPIRO[CYCLOPROPANE-L,3'-INDOLIN]-2'-ONE FUMARATE
Disclosed is Crystal Form S4 of a fumarate salt of compound (I) represented by the following structural formula: (I) The molar ratio between compound (I) and fumaric acid is 1.0:1:0. Crystal Form S4, 5 characterized by an X-ray powder diffraction pattern which comprises peaks at 6.6°, 9.8°, 16.3°, 21.1°, 28.7°, and 30.2° ± 0.2 in 2?.
C07D 413/10 - Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing aromatic rings
A61K 31/191 - Acyclic acids having two or more hydroxy groups, e.g. gluconic acid
A61K 31/5377 - 1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
A system and method for providing and managing a remote patient monitoring (RPM) system. The method is implemented by a central server, an RPM client, and a networked monitoring device. The RPM client is a software program that is executed by a computing device that is connected to the server via a network. The networked monitoring device is implemented as a locator or a smart mobile cart. More specifically, the RPM system can provide a tele-monitor with the ability to remotely monitor multiple patients, control remote cameras, and address abnormal patient situations. The RPM system can enhance tele-monitor effectiveness by detecting patient motion and tracking tele-monitor alertness.
G16H 40/67 - ICT specially adapted for the management or administration of healthcare resources or facilities; ICT specially adapted for the management or operation of medical equipment or devices for the operation of medical equipment or devices for remote operation
H04W 4/00 - Services specially adapted for wireless communication networks; Facilities therefor
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
The present disclosure is directed recombinant T cell receptors capable of binding a tyrosinase epitope, a MAGA-A1 epitope, a MART1 epitope, a MAGE-A3 epitope, or an SSX2 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
A61K 31/675 - Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
A61K 35/12 - Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
C07F 9/6584 - Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and nitrogen atoms with or without oxygen or sulfur atoms, as ring hetero atoms having one phosphorus atom as ring hetero atom
The invention provides novel anti-TSG-6 antibodies, pharmaceutical compositions comprising such antibodies, and therapeutic methods of using such antibodies and pharmaceutical compositions for the treatment of diseases such as cancer or autoimmune disease.
The present disclosure is directed recombinant T cell receptors capable of binding an NY-ESO-1 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
A61K 31/675 - Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
A61K 35/12 - Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
C07F 9/6584 - Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and nitrogen atoms with or without oxygen or sulfur atoms, as ring hetero atoms having one phosphorus atom as ring hetero atom
The present disclosure is directed recombinant T cell receptors capable of binding a gp100 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
A61K 31/675 - Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
A61K 35/12 - Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
C07F 9/6584 - Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and nitrogen atoms with or without oxygen or sulfur atoms, as ring hetero atoms having one phosphorus atom as ring hetero atom
The present disclosure is directed recombinant T cell receptors capable of binding an gp100 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
A61K 31/675 - Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
A61K 35/12 - Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
C07F 9/6584 - Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and nitrogen atoms with or without oxygen or sulfur atoms, as ring hetero atoms having one phosphorus atom as ring hetero atom
The present disclosure is directed recombinant T cell receptors capable of binding an NY-ESO-1 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
A61K 31/675 - Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
A61K 35/12 - Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
C07F 9/6584 - Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and nitrogen atoms with or without oxygen or sulfur atoms, as ring hetero atoms having one phosphorus atom as ring hetero atom
The present disclosure is directed recombinant T cell receptors capable of binding an NY-ESO-1 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
A61K 31/675 - Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
C07F 9/6584 - Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and nitrogen atoms with or without oxygen or sulfur atoms, as ring hetero atoms having one phosphorus atom as ring hetero atom
The present disclosure is directed recombinant T cell receptors capable of binding a gp100 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
The present disclosure is directed recombinant T cell receptors capable of binding a gp100 epitope and nucleic acid molecules encoding the same. In some embodiments, the nucleic acid molecules further comprise a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of an endogenous TCR. Other aspects of the disclosure are directed to vectors comprising the nucleic acid molecule and cells comprising the recombinant TCR, the nucleic acid molecule, or the vector. Still other aspects of the disclosure are directed to methods of using the same. In some embodiments, the methods comprise treating a cancer in a subject in need thereof.
A61K 31/675 - Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
A61K 35/12 - Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
C07F 9/6584 - Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and nitrogen atoms with or without oxygen or sulfur atoms, as ring hetero atoms having one phosphorus atom as ring hetero atom
The invention provides novel anti-FCMR antibodies, pharmaceutical compositions comprising such antibodies, and therapeutic methods of using such antibodies and pharmaceutical compositions for the treatment of diseases such as cancer or autoimmune disease.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61P 31/00 - Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
The invention provides novel anti-LILRB3 antibodies, pharmaceutical compositions comprising such antibodies, and therapeutic methods of using such antibodies and pharmaceutical compositions for the treatment of diseases such as cancer, autoimmune disease, or allergic inflammation. This invention can also be used to modulate osteoclast differentiation.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
A61K 39/395 - Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61P 29/00 - Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
A tissue phantom is disclosed. The tissue phantom includes a first portion having the optical properties of healthy tissue and a second portion having the optical properties of cancerous tissue. Additionally, a method of calibrating an optical instrument is disclosed. The method includes illuminating a tissue phantom with excitation light from the optical instrument, detecting optical emissions emitted by the tissue phantom in response to illumination with the excitation light, and calibrating the optical instrument based upon the detected fluorescence.
G01N 21/00 - Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
G01N 21/63 - Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
A tissue phantom is disclosed. The tissue phantom includes a first portion having the optical properties of healthy tissue and a second portion having the optical properties of cancerous tissue. Additionally, a method of calibrating an optical instrument is disclosed. The method includes illuminating a tissue phantom with excitation light from the optical instrument, detecting optical emissions emitted by the tissue phantom in response to illumination with the excitation light, and calibrating the optical instrument based upon the detected fluorescence.
The present disclosure provides methods, systems, and devices for coregistering imaging data to form three-dimensional superimposed images of target such as a tumor or a surgical bed. A three-dimensional map can be generated by projecting infrared radiation at a target area, receiving reflected infrared radiation, and measuring depth of the target area. A three-dimensional white light image can be created from a captured two-dimensional white light image and the three-dimensional map. A three-dimensional fluorescence image can be created from a captured two-dimensional fluorescence image and the three-dimensional map. The three-dimensional white light image and the three-dimensional fluorescence image can be aligned using one or more fiducial markers to form a three-dimensional superimposed image. The superimposed image can be used to excise cancerous tissues, for example, breast tumors. Images can be in the form of videos.
G16H 30/40 - ICT specially adapted for the handling or processing of medical images for processing medical images, e.g. editing
G01B 11/25 - Measuring arrangements characterised by the use of optical techniques for measuring contours or curvatures by projecting a pattern, e.g. moiré fringes, on the object
G01N 21/84 - Systems specially adapted for particular applications
G01S 17/89 - Lidar systems, specially adapted for specific applications for mapping or imaging
G06T 15/00 - 3D [Three Dimensional] image rendering
67.
PRODUCTION AND THERAPEUTIC USE OF OFF-THE-SHELF DOUBLE NEGATIVE T CELLS
Described are methods for the production and use of cryopreservable double negative T cells (DNTs) for the treatment of cancer as an off-the-shelf cellular therapy. A sample population of DNTs is expanded using DNTs from one or more donors. The expanded population of DNTs from different donors does not exhibit alloreactivity against allogenic cells in the expanded population. The expanded populations of DNTs can be long-term stored as cryopreserved products.
Methods and kits for screening, diagnosing, detecting or predicting a patient outcome/risk variable for a lung transplant recipient after transplant or an EVLP outcome by measuring biomarker levels of at least three biomarkers selected from IL-6, IL-8, IL-10 and IL-1ß optionally in combination with one or both of sTNFR1 and sTREM1 in EVLP perfusate are described. The methods involve for example, i. obtaining one or more test EVLP perfusate samples of a donor lung; ii. determining in one or more test EVLP perfusate sample of a donor lung, a polypeptide level of the at least three biomarkers selected from IL-8, IL-6, IL-10 and IL-1ß and optionally one or both of sTNFR1 and sTREM1 i; and iii. a) comparing the one or more parameter values related to a level of the at least three biomarkers in the perfusate sample with control EVLP data or a cut-off level, wherein the differential level is indicative of outcome/risk of after transplant or of an EVLP outcome; or b) using the one or more parameter values related to a level of the at least three biomarkers in combination, as part of an algebraic calculation or model of outcome/risk.
G01N 33/48 - Biological material, e.g. blood, urine; Haemocytometers
G06F 16/90 - Information retrieval; Database structures therefor; File system structures therefor - Details of database functions independent of the retrieved data types
Disclosed herein are methods of producing a population of venous angioblast cells from stem cells using a venous angioblast inducing media and optionally isolating a CD34+ population from the cell population comprising the venous angioblast cells, for example using a CD34 affinity reagent, CD31 affinity reagent and/or CD144 affinity reagent, optionally with or without a CD73 affinity reagent as well as methods of further differentiating the venous angioblasts in vitro to produce SEC-LCs and/or in vivo to produce SECs. Uses of the cells and compositions comprising the cells are also described.
A61P 1/16 - Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
C12Q 1/02 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
Provided herein are perfusion fluids for enzymatically cleaving A-antigens from a donor organ, and methods, uses, associated therewith. In particular, the perfusion fluids comprise two enzymes, GalNAcDeacetylase and Galactosaminidase and the fluids may further comprise a buffered extracellular solution and/or a crowing agent. Furthermore, the compositions described herein were found to have activity at temperatures and pH levels suitable for cell viability.
Methods for the treatment of cancer using double negative T cells (DNTs) and a PD-1 or PD-L1 inhibitor are described. Tumors treated with DNTs and a PD- 1 inhibitor exhibited increased DNT cell infiltration and increased cytotoxicity towards non-small cell lung cancer (NSCLC) cells. Also described are compositions and kits comprising DNTs and a PD-1 or PD-L1 inhibitor and their use for the treatment of cancer.
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
There is described herein a method of predicting recurrence free survival in a patient with meningioma comprising: (a) determining a tumor DNA methylation profile from a tumor sample from the patient, the tumor DNA methylation profile comprising the methylation status of at least 200 loci represented by the probes set forth in Table 9; and (b) calculating a risk of meningioma recurrence based on comparing the tumor DNA methylation profile and a reference methylation profile comprising the extent to which the methylation status of the at least 200 loci is associated with a risk of recurrence.
THE GOVERNING COUNCIL OF THE UNIVERSITY OF TORONTO (Canada)
THE UNIVERSITY OF WESTERN ONTARIO (Canada)
UNIVERSITY HEALTH NETWORK (Canada)
Inventor
Rudzicz, Frank
Boger, Jennifer Netanis
Chinaei, Hamidreza
Polgar, Janice Ann
Wambua, Muuo
Abstract
A system, method and computer program product for query clarification are described. Data from a corpus is automatically labelled using a trained classifier. The labels are assigned to indicator variables that each relate to the context of each data. During query, a decision tree is generated from the search results in such a way as to maximize information gain obtainable from a question:answer pair that can be posed to the user. The search results can be narrowed by obtaining the answer and correspondingly pruning the decision tree.
There is described herein methods of treating a disease associated with extracellular matrix (ECM) in a patient. In some cases, the methods comprise administering to the patient a therapeutically effective amount of fibroblasts which express CD36.
Methods and compositions are provided for producing PDX1+/NKX6-1+ pancreatic progenitor cells from a PDX1+ endodermal cell population. The method comprises contacting the endodermal cell population with an EGF component and tankyrase inhibitor that binds to an adenosine subsite of a tankyrase enzyme, to induce the differentiation of at least a portion of the PDX1+ endodermal cell population into PDX1+NKX6-1+ pancreatic progenitor cells.
A61K 31/519 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
C12Q 1/6809 - Methods for determination or identification of nucleic acids involving differential detection
A61K 31/4184 - 1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
A61K 31/437 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
A61K 31/4985 - Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems
A61K 31/5025 - Pyridazines; Hydrogenated pyridazines ortho- or peri-condensed with heterocyclic ring systems
A61K 31/517 - Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
A61K 31/55 - Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
System, method and computer program product of assessing the likelihood of response to cardiac resynchronization therapy (CRT) for a patient. ECG data is obtained from the patient and is analyzed to detect abnormal QRS peaks. A5 likelihood of the patient responding to CRT is determined based on the number of abnormal QRS peaks detected. An indication of whether the patient is a candidate for CRT can be provided based on the determined likelihood of CRT response. This indication can be used to guide treatment for the patient.
A61B 5/366 - Detecting abnormal QRS complex, e.g. widening
G16H 20/00 - ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance
78.
DEVICE AND METHOD FOR DETERMINING DEPTH AND CONCENTRATION OF A SUBSURFACE FLUORESCENT OBJECT
A method and device for determining the depth and fluorophore concentration of a fluorophore concentration below the surface of an optically absorbing and scattering medium suitable for use in fluorescence-based surgical guidance such as in tumor resection is described. Long-wavelength stimulus light us used to obtain deep tissue penetration. Recovery of depth is performed by fitting measured modulation amplitudes for each spatial frequency to precomputed modulation amplitudes in a table of modulation amplitudes indexed by optical parameters and depth.
The present invention provides a method of producing the composite comprising: a) melt blending the matrix with the fibers to produce a melted composite, b) injecting the melted composite into a mold and allowing the melted composite to solidify and, c) removing at least a portion of the outermost layer of a composite such that the fibers protrude from the surface of the composite. Also provided is composite produced by the methods of the invention comprising soft and hard fibers embedded in a soft rubber-like matrix, wherein the fibers protrude from the composite's surface. In specific embodiments, the composite comprises carbon fibers and poly(p-phenylene-2,6-benzobisoxazole) (PBO) fibers in a thermoplastic polyurethane (TPU) matrix, wherein the fibers protrude from the composite's surface. Slip-resistant product comprising the composite are also provided.
B29C 70/30 - Shaping by lay-up, i.e. applying fibres, tape or broadsheet on a mould, former or core; Shaping by spray-up, i.e. spraying of fibres on a mould, former or core
C08J 5/14 - Manufacture of abrasive or friction articles or materials
80.
DEVICES, SYSTEMS, AND METHODS FOR TUMOR VISUALIZATION AND REMOVAL
A method of assessing surgical margins is disclosed. The method includes, subsequent to administration of a compound configured to induce emissions of between about 600 nm and about 660 nm in cancerous tissue cells, positioning a distal end of a handheld, white light and fluorescence-based imaging device adjacent to a surgical margin. The method also includes, with the handheld device, substantially simultaneously exciting and detecting autofluorescence emissions of tissue cells and fluorescence emissions of the induced wavelength in tissue cells of the surgical margin. And, based on a presence or an amount of fluorescence emissions of the induced wavelength detected in the tissue cells of the surgical margin, determining whether the surgical margin is substantially free of at least one of precancerous cells, cancerous cells, and satellite lesions. The compound may be a non-activated, non-targeted compound such as ALA.
A61B 5/00 - Measuring for diagnostic purposes ; Identification of persons
G06T 7/90 - Determination of colour characteristics
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
There is described herein a method of detecting the presence of DNA from cancer cells in a subject comprising: providing a sample of cell-free DNA from a subject; subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA; optionally denaturing the sample; capturing cell-free methylated DNA using a binder selective for methylated polynucleotides; sequencing the captured cell-free methylated DNA; comparing the sequences of the captured cell- free methylated DNA to control cell-free methylated DNAs sequences from healthy and cancerous individuals; identifying the presence of DNA from cancer cells if there is a statistically significant similarity between one or more sequences of the captured cell- free methylated DNA and cell-free methylated DNAs sequences from cancerous individuals.
Embodiments described herein provide a platform, device and process for digital pathology that enable multi-level annotation and visualization of histopathologic slides using a modular arrangement of deep convolutional neural networks (CNNs). The CNNs can be trained using pathology images (e.g., in some cases increasing the base of data by breaking larger fields of view into smaller ones) to learn features consistent with certain pathologies. The platform can use the CNNs to visually annotate pathology slides at an interface tool of a display device. The platform can automate the process of selection, as well as provide an opportunity for the pathologist to see a depiction of predicted results. The platform can use the CNNs to identify regions of interest on pathology slides. The interface tool can enable a predicted region of interest (ROI) type to be visually presented on a surface map showing the basis of the prediction. If the ROI primarily lands in part of the hyperdimensional space not occupied by any training set, then the interface tool is capable of marking it as an ROI of unknown type.
G06V 10/25 - Determination of region of interest [ROI] or a volume of interest [VOI]
A61B 90/00 - Instruments, implements or accessories specially adapted for surgery or diagnosis and not covered by any of the groups , e.g. for luxation treatment or for protecting wound edges
G06V 10/764 - Arrangements for image or video recognition or understanding using pattern recognition or machine learning using classification, e.g. of video objects
G06V 10/82 - Arrangements for image or video recognition or understanding using pattern recognition or machine learning using neural networks
Provided herein are methods of treating cancer using an effective amount of a compound represented by the formula (Formula (I)) or a pharmaceutically acceptable salt thereof and an effective amount of an immune checkpoint inhibitor. Also provided are compositions comprising the same compound represented by the formula shown above or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor.
C07D 413/10 - Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a carbon chain containing aromatic rings
84.
GENERATION OF OLIGODENDROGENIC NEURAL PROGENITOR CELLS
Provided herein are methods of producing, compositions comprising and uses of oligodendrogenic neural progenitor cells (o-NPCs), made using a combination of PDGFR agonist and thyroxin or a thyroxin analogue. The method includes; obtaining ventralized neural progenitor cells (NPCs), the ventralized NPCs expressing Sox2, Nkx6-1, decreased level of Pax6 compared to unpatterned NPCs, and elevated expression of HoxA4 compared to unpatterned NPCs; culturing the ventralized NPCs for about 12 to about 16 days (days 26-40 of Fig. 7; days 12 to 27 of Fig. 10) in neural expansion media (NEM) supplemented with i) PDGFR agonist for the about 12 to about 16 days and ii) thyroxine or a thyroxine analogue for the latter about 7 to about 9 days, to produce o-NPC expressing Sox2 and Nkx2.2, decresed level of Pax6 and Nkx6.1 compared to ventralized NPCs and elevated level of HoxA4 and Olig2 compared to ventralized NPCs.
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
Methods and kits for screening, diagnosing, detecting or predicting a patient outcome/risk variable for a lung transplant recipient after transplant or an EVLP outcome by measuring biomarker levels of one or more biomarkers selected from IL-6, IL-8, sTNFR1 and sTREM-1 in EVLP perfusate are described. The methods involve for example, i. obtaining one or more test EVLP perfusate samples of a donor lung; ii. determining in one or more test EVLP perfusate sample of a donor lung, a polypeptide level of one or more biomarkers selected from IL-8, IL-6, sTNFR1 and sTREM-1; and iii. a) comparing the polypeptide level of the one or more biomarkers in the perfusate sample with a control or cut-off level, wherein the differential level is indicative of outcome/risk of after transplant or of an EVLP outcome; or b) using the polypeptide level of one or several of the one or more biomarkers in combination, as part of an algebraic calculation of outcome/risk.
Provided herein are methods of treating cancer using an effective amount of a compound represented by the formula: (I) or a pharmaceutically acceptable salt thereof and an effective amount of an immune checkpoint inhibitor. Also provided are compositions comprising the same compound represented by the formula shown above or a pharmaceutically acceptable salt thereof and an immune checkpoint inhibitor.
Provided herein are methods of producing, compositions comprising and uses of oligodendrogenic neural progenitor cells (o-NPCs), made using a combination of PDGF and thyroxin or a thyroxin analogue. The method includes; obtaining ventralized neural progenitor cells (NPCs), the ventralized NPCs expressing Sox2, Nkx6-1, decreased level of Pax6 compared to unpatterned NPCs, and elevated expression of HoxA4 compared to unpatterned NPCs; culturing the ventralized NPCs for about 12 to about 16 days (days 26-40 of Fig. 7; days 12 to 27 of Fig. 10) in neural expansion media (NEM) supplemented with i) PDGF for the about 12 to about 16 days and ii) thyroxine or a thyroxine analogue for the latter about 7 to about 9 days, to produce o-NPC expressing Sox2 and Nkx2.2, decresed level of Pax6 and Nkx6.1 compared to ventralized NPCs and elevated level of HoxA4 and Olig2 compared to ventralized NPCs.
A61P 25/00 - Drugs for disorders of the nervous system
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
88.
CONDUCTIVE BENZOIC ACID BASED POLYMER CONTAINING BIOMATERIAL FOR ENHANCEMENT OF TISSUE CONDUCTION IN VITRO AND IN VIVO
The present disclosure relates to a biocompatible, electrically conductive biomaterial capable of carrying the electrical potential of a cardiac impulse. The biomaterial comprises a conductive polymer and a biocompatible component. The conductive polymer comprising an aminomethoxybenzoic acid (AMBA) polymer. The present disclosure also relates to treatments, uses and devices using the biocompatible, electrically conductive biomaterial.
C08L 77/00 - Compositions of polyamides obtained by reactions forming a carboxylic amide link in the main chain; Compositions of derivatives of such polymers
A61K 47/30 - Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
A61K 47/42 - Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
A61K 50/00 - Electrically conductive preparations for use in therapy or testing in vivo, e.g. conductive adhesives or gels to be used with electrodes for electrocardiography (ECG) or for transcutaneous drug administration
A61N 1/05 - Electrodes for implantation or insertion into the body, e.g. heart electrode
A61P 9/00 - Drugs for disorders of the cardiovascular system
C08L 89/06 - Products derived from waste materials, e.g. horn, hoof or hair derived from leather or skin
89.
CANCER DETECTION AND CLASSIFICATION USING METHYLOME ANALYSIS
There is described herein a method of detecting the presence of DNA from cancer cells in a subject comprising: providing a sample of cell-free DNA from a subject; subjecting the sample to library preparation to permit subsequent sequencing of the cell-free methylated DNA; adding a first amount of filler DNA to the sample, wherein at least a portion of the filler DNA is methylated, then optionally denaturing the sample; capturing cell-free methylated DNA using a binder selective for methylated polynucleotides; sequencing the captured cell-free methylated DNA; comparing the sequences of the captured cell-free methylated DNA to control cell-free methylated DNAs sequences from healthy and cancerous individuals and from individuals with distinct cancer types and subtypes; identifying the presence of DNA from cancer cells if there is a statistically significant similarity between one or more sequences of the captured cell-free methylated DNA and cell-free methylated DNAs sequences from cancerous individuals.
C12Q 1/6809 - Methods for determination or identification of nucleic acids involving differential detection
C12Q 1/6886 - Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
C12Q 1/68 - Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
90.
HYBRID-CAPTURE SEQUENCING FOR DETERMINING IMMUNE CELL CLONALITY
In an aspect, there is provided, a method of capturing a population of T-Cell receptor and/or immunoglobulin sequences with variable regions within a patient sample, said method comprising: extracting/preparing DNA fragments from the patient sample; ligating a nucleic acid adapter to the DNA fragments, the nucleic acid adapter suitable for recognition by a pre-selected nucleic acid probe; capturing DNA fragments existing in the patient sample using a collection of nucleic acid hybrid capture probes, wherein each capture probe is designed to hybridize to a known V gene segment and/or a J gene segment within the T cell receptor and/or immunoglobulin genomic loci.
C40B 30/04 - Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
Systems and methods for performing perfusion and contractility assessments for a heart are provided. The system can operate in any of Langendorff mode, pump-supported working mode, passive working mode, and right-sided working mode. The system includes a reservoir from which one or more pumps are operable to supply a heart with fluids and collect fluids output therefrom. One or more clamps can be used to switch between Langendorff, pump-supported, passive, and right-sided working modes.
Methods and compositions for inhibiting or preventing neurodegeneration, specifically hippocampal, cortical, and/or retinal ganglion cell neurons (RGC), and degeneration and/or cell loss or treating related disorders and diseases comprising administering to a subject an effective amount of one or more lipoxin compounds and/or lipoxin analogues such that degeneration and/or cell loss of neurons is inhibited or prevented.
A61P 25/00 - Drugs for disorders of the nervous system
A61P 25/28 - Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
C07C 59/42 - Unsaturated compounds containing hydroxy or O-metal groups
94.
METHOD AND SYSTEM FOR BRAIN ACTIVITY SIGNAL-BASED TREATMENT AND/OR CONTROL OF USER DEVICES
A method for characterizing a brain electrical signal comprising forming a temporo-spectral decomposition of the signal to form a plurality of time resolved frequency signal values, associating each instance of the signal value with a predetermined function approximating a neurological signal to form a table of coefficients collectively representative of the brain electrical signal.
G16H 20/30 - ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to physical therapies or activities, e.g. physiotherapy, acupressure or exercising
G16H 20/70 - ICT specially adapted for therapies or health-improving plans, e.g. for handling prescriptions, for steering therapy or for monitoring patient compliance relating to mental therapies, e.g. psychological therapy or autogenous training
G16H 40/63 - ICT specially adapted for the management or administration of healthcare resources or facilities; ICT specially adapted for the management or operation of medical equipment or devices for the operation of medical equipment or devices for local operation
G16H 50/20 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for computer-aided diagnosis, e.g. based on medical expert systems
G16H 50/30 - ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for individual health risk assessment
A61N 1/36 - Applying electric currents by contact electrodes alternating or intermittent currents for stimulation, e.g. heart pace-makers
G06F 3/01 - Input arrangements or combined input and output arrangements for interaction between user and computer
95.
ANTI-TUMOR T CELLS AND THEIR PREPARATION USING IL-6
There is described herein a method for inducing Tc22 lineage T cells from a population of CD8+ T cells, the method comprising: a) providing a population of CD8+ T cells; b) activating the population of CD8+ T cells; and c) culturing or contacting the population of CD8+ T cells with IL-6.
C07K 16/22 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors
C07K 16/24 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
96.
ANTI-CANCER T CELLS AND THEIR PREPARATION USING COENZYME A
There is described herein, a method for inducing Tc22 lineage T cells from a population of CD8+ T cells, the method comprising: a) providing a population of CD8+ T cells; b) activating the population; and c) culturing or contacting the population of CD8+ T cells with Coenzyme A.
A61K 31/7076 - Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
A61P 1/00 - Drugs for disorders of the alimentary tract or the digestive system
C07K 16/22 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors
C07K 16/28 - Immunoglobulins, e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
97.
GENERATING ATRIAL AND VENTRICULAR CARDIOMYOCYTE LINEAGES FROM HUMAN PLURIPOTENT STEM CELLS
Methods are disclosed for producing populations of cardiomyocytes from pluripotent stem cells. Populations may be enriched for either atrial or ventricular cardiomyocytes and the resulting ventricular population may be essentially free of pacemaker cells. The method includes incubating pluripotent stem cells in a suitable medium with a BMP component, and an activin component, the amounts of activin may be varied to enrich for either atrial or ventricular cardiomyocytes. The enriched populations, as well as methods of using the same to treat patients in need of cardiac repair are disclosed.
The present invention relates to a novel co-crystal of the compound of formula (I): (Formula (I)) wherein the co-former molecule is bisphosphate hemihydrate, to processes for the preparation of the co-crystal, to pharmaceutical compositions containing the co-crystal, to the use of such a co-crystal in the manufacture of a medicament for use in the treatment of cancer and to methods of treating such diseases in the human or animal body by administering a therapeutically effective amount of such a co-crystal.
C30B 7/02 - Single-crystal growth from solutions using solvents which are liquid at normal temperature, e.g. aqueous solutions by evaporation of the solvent
Methods and systems are provided for ionizing molecules for the purpose of analysis by mass spectrometry, in which gaseous material from a sample substrate is generated using laser desorption The laser is provided having a pulse range of about 1-1000 picoseconds to produce the gaseous material The gaseous material is heated to generate ions from the molecules present in the gaseous material where the amount of heat that is applied is in the temperature range of 45 °C to 250 °C and the applied heat results in soft ionization of the molecules The ionized molecules are transported to a mass spectrometer for analysis
H01J 27/24 - Ion sources; Ion guns using photo-ionisation, e.g. using laser beam
H01J 49/04 - Arrangements for introducing or extracting samples to be analysed, e.g. vacuum locks; Arrangements for external adjustment of electron- or ion-optical components
100.
DEVICES AND PROCESSES FOR CHERENKOV-ACTIVATED NUCLEAR-TARGETED PHOTODYNAMIC THERAPY
THE GOVERNING COUNCIL OF THE UNIVERSITY OF TORONTO (Canada)
Inventor
Wilson, Brian C.
Allen, Christine
Abstract
Devices, materials, compounds, systems, and processes for Cherenkov-Activated Nuclear-Targeted Photodynamic Therapy that involves generating Cherenkov light within the tissue of a target volume and using this light to activate photosensitizing material that is located in the nucleus of cells of the target volume.
A61K 41/00 - Medicinal preparations obtained by treating materials with wave energy or particle radiation
C12N 13/00 - Treatment of microorganisms or enzymes with electrical or wave energy, e.g. magnetism, sonic waves
C12N 15/00 - Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor